Previous Contig 009377:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025B04Sequence591009377 (6)gb:AY181256_15875942e-61Stylosanthes hamata cation diffusion facilitator 8 mRNA, complete cds.795009377 (6)gb:AY181256_15875944e-46Stylosanthes hamata cation diffusion facilitator 8 mRNA, complete cds.
JMSF023H21Sequence662009377 (6)gb:AY181256_1587594e-103Stylosanthes hamata cation diffusion facilitator 8 mRNA, complete cds.753009377 (6)gb:AY181256_15875942e-47Stylosanthes hamata cation diffusion facilitator 8 mRNA, complete cds.
JMSF033G04Sequence717009377 (6)gb:AY181256_15875943e-36Stylosanthes hamata cation diffusion facilitator 8 mRNA, complete cds.701009377 (6)gb:AY181256_15875942e-46Stylosanthes hamata cation diffusion facilitator 8 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033G04- TGGGGACCAAAAGTCAAT
                      ____________________________________________________________
consensus TGGGGACCAAAAGTCAAT
 
. : . : . : . : . : . :
JMSF033G04- AGCAAACAGAATTACAAATACTACCGCGAAAATTCAGATTATGGAATATAAATTTACTTG
                      ____________________________________________________________
consensus AGCAAACAGAATTACAAATACTACCGCGAAAATTCAGATTATGGAATATAAATTTACTTG
 
. : . : . : . : . : . :
JMSF033G04- AATCAATATTGAATAATCATCTAATTTATCAATTTAAAATGATTATGTGATAAAAAAAAA
                      ____________________________________________________________
consensus AATCAATATTGAATAATCATCTAATTTATCAATTTAAAATGATTATGTGATAAAAAAAAA
 
. : . : . : . : . : . :
JMSF033G04- TGATTATGGGATAAGAGCTGCTTCGTTTCTATATAATTTTGTGGTTCGGCGGATGAGATT
                      ____________________________________________________________
consensus TGATTATGGGATAAGAGCTGCTTCGTTTCTATATAATTTTGTGGTTCGGCGGATGAGATT
 
. : . : . : . : . : . :
JMSF033G04- GAATTGAGTCGGAACGGTGAGAATGGCGAGCAGTGAGGCTGACATGGACGTCAAATCGCC
JMFF025B04- TGAGAATGGCGAGCAGTGAGGCTGACATGGACGTCAAATCGCC
                      ____________________________________________________________
consensus GAATTGAGTCGGAACGGTGAGAATGGCGAGCAGTGAGGCTGACATGGACGTCAAATCGCC
 
. : . : . : . : . : . :
JMSF033G04- GCTGCTGGACGGCGGGAAGTCCGGCGGAGGAGGCGGCAGCGGCCGGCGTAGCCAGCTGAT
JMFF025B04- GCTGCTGGACGGCGGGAAGTCCGGCGGAGGAGGCGGCAGCGGCCGGCGTAGCCAGCTGAT
                      ____________________________________________________________
consensus GCTGCTGGACGGCGGGAAGTCCGGCGGAGGAGGCGGCAGCGGCCGGCGTAGCCAGCTGAT
 
. : . : . : . : . : . :
JMSF033G04- TTCCAGACGGAACTCGGTTACGTTGCTCCGCAGTGATTTTCTGGCTCGGCTACCGGACAA
JMFF025B04- TTCCAGACGGAACTCGGTTACGTTGCTCCGCAGTGATTTCCTGGCTCGGCTACCGGACAA
                      ____________________________________________________________
consensus TTCCAGACGGAACTCGGTTACGTTGCTCCGCAGTGATTTTCTGGCTCGGCTACCGGACAA
 
. : . : . : . : . : . :
JMSF033G04- GGTTCGCTCCTACATTGATCCTGAGTCTTTTTCTCCGGTTGACCTCTCCAAATCCTCTAC
JMFF025B04- GGTTCGCTCCTACATTGATCCTGAGTCTTTTTCTCCGGTTGACCTCTCCAAATCCTCTAC
                      ____________________________________________________________
consensus GGTTCGCTCCTACATTGATCCTGAGTCTTTTTCTCCGGTTGACCTCTCCAAATCCTCTAC
 
. : . : . : . : . : . :
JMSF033G04- TTTAACGAAAGGAGAAAAAGAATATTATGAAAGACAATTTGCAACCCTAAAGTCGTTTGA
JMFF025B04- TTTAACGAAAGGAGAAAAAGAATATTATGAAAGACAATTTGCAACCCTAAAGTCGTTTGA
                      ____________________________________________________________
consensus TTTAACGAAAGGAGAAAAAGAATATTATGAAAGACAATTTGCAACCCTAAAGTCGTTTGA
 
. : . : . : . : . : . :
JMSF033G04- ATGTGTTGATATTGTGAGTGCATCTAACTGCATTGATGAAGAAGATCTTGAGGAACAAGC
JMFF025B04- ATGTGTTGATATTGTGAGTGCATCTAACTGCATTGATGAAGAAGATCTTGAGGAACAAGC
                      ____________________________________________________________
consensus ATGTGTTGATATTGTGAGTGCATCTAACTGCATTGATGAAGAAGATCTTGAGGAACAAGC
 
. : . : . : . : . : . :
JMSF033G04- CCAACATGAGAGAGCAATGAAGATTTCTAATTATGCAAATATAATACTACTGGTTCTTAA
JMFF025B04- CCAACATGAGAGAGCAATGAAGATTTCTAATTATGCAAATATAATACTACTGGTTCTTAA
                      ____________________________________________________________
consensus CCAACATGAGAGAGCAATGAAGATTTCTAATTATGCAAATATAATACTACTGGTTCTTAA
 
. : . : . : . : . : . :
JMSF033G04- GATCTATGCTACAGTAAGAAGTGGATCCATAGCCNTTGCTGCATCAACATTGGATTCCTT
JMFF025B04- GATCTATGCTACAGTAAGAAGTGGATCCATAGCCATTGCTGCATCAACATTGGATTCCTT
JMSF023H21- TCTATGCTACAGTAAGAAGTGGATCCATAGCCATTGCTGCATCAACATTGGATTCCTT
                      ____________________________________________________________
consensus GATCTATGCTACAGTAAGAAGTGGATCCATAGCCATTGCTGCATCAACATTGGATTCCTT
 
. : . : . : . : . : . :
JMSF033G04- ACTTGATCTCATGGCTGGTGGTATATTATGGCTAACTCA
JMFF025B04- ACTTGATCTCATGGCTGGTGGTATATTATGGCTAACTCACTTATCAATGAAAAGTGTTAA
JMSF023H21- ACTTGATCTCATGGCTGGTGGTATATTATGGCTAACTCACTTATCAATGAAAAGTGTTAA
                      ____________________________________________________________
consensus ACTTGATCTCATGGCTGGTGGTATATTATGGCTAACTCACTTATCAATGAAAAGTGTTAA
 
. : . : . : . : . : . :
JMFF025B04- TATCTATAAATATCCTATTGGGAAACTGAGAATGCAGCCAGTAGGCATTATTATCTTTGC
JMSF023H21- TATCTATAAATATCCTATTGAGAAACTGAGAATGCAGCCAGTAGGCATTATTATCTTTGC
                      ____________________________________________________________
consensus TATCTATAAATATCCTATTGGGAAACTGAGAATGCAGCCAGTAGGCATTATTATCTTTGC
 
. : . : . : . : . : . :
JMFF025B04- TGCAGTCA
JMSF023H21- TGCAGTCATGGCTACACTGGGTTTTCAGGTATTGATTCAGGCTGTAGAAAAACTTATTCA
                      ____________________________________________________________
consensus TGCAGTCATGGCTACACTGGGTTTTCAGGTATTGATTCAGGCTGTAGAAAAACTTATTCA
 
. : . : . : . : . : . :
JMSF023H21- ACATGCACCTTCTGATAAAATGACCTCAGATCAACTGGCATGGCTGTATAGCATCATGAT
                      ____________________________________________________________
consensus ACATGCACCTTCTGATAAAATGACCTCAGATCAACTGGCATGGCTGTATAGCATCATGAT
 
. : . : . : . : . : . :
JMSF023H21- AACTGCCACTGTGGTAAAACTTTGTCTTTGGATCTACTGTAGAAGTTCAGGGAATGACAT
                      ____________________________________________________________
consensus AACTGCCACTGTGGTAAAACTTTGTCTTTGGATCTACTGTAGAAGTTCAGGGAATGACAT
 
. : . : . : . : . : . :
JMSF023H21- TGTTAAAGCCTATGCAAAGGATCATTATTTTGATGTTGTCACAAATCTAGTAGGATTGTT
                      ____________________________________________________________
consensus TGTTAAAGCCTATGCAAAGGATCATTATTTTGATGTTGTCACAAATCTAGTAGGATTGTT
 
. : . : . : . : . : . :
JMSF023H21- AGCTGCTGTACTTGGAGATAAATTTTACTGGTGGATTGATCCCACTGGGGCCATTATCCT
                      ____________________________________________________________
consensus AGCTGCTGTACTTGGAGATAAATTTTACTGGTGGATTGATCCCACTGGGGCCATTATCCT
 
. : . : . : . : . : . :
JMSF023H21- TGCAATTTACACAATCACAAATTGGTCTGGAACTGTCCTAGAGAATGCAGCATCACTAGT
rJMSF033G04+ AATGCAGCATCACTAGT
rJMSF023H21+ AATGCAGCATCACTAGT
rJMFF025B04+ AATGCAGCATCACTAGT
                      ____________________________________________________________
consensus TGCAATTTACACAATCACAAATTGGTCTGGAACTGTCCTAGAGAATGCAGCATCACTAGT
 
. : . : . : . : . : . :
JMSF023H21- AGGACGATCAGCCCCTCCCGAAGTATTGCAGAAGTTAACATATCTAGTCGTGCAGCACCC
rJMSF033G04+ AGGACGATCAGCCCCTCCCGAAGTATTGCAGAAGTTAACATATCTAGTCGTGCAGCACCC
rJMSF023H21+ AGGACGATCAGCCCCTCCCGAAGTATTGCAGAAGTTAACATATCTAGTCGTGCAGCACCC
rJMFF025B04+ AGGACGATCAGCCCCTCCCGAAGTATTGCAGAAGTTAACATATNTAGTCGTGCAGCACCC
                      ____________________________________________________________
consensus AGGACGATCAGCCCCTCCCGAAGTATTGCAGAAGTTAACATATCTAGTCGTGCAGCACCC
 
. : . : . : . : . : . :
JMSF023H21- TAAAGTCAAACGCGTTGACACAGTCCGAGCATATACCTTTGGTGTCTTGTACTTTGTTGA
rJMSF033G04+ TAAAGTCAAACGCGTTGACACAGTCCGAGCATATACCTTTGGTGTCTTGTACTTTGTTGA
rJMSF023H21+ TAAAGTCAAACGCGTTGACACAGTCCGAGCATATACCTTTGGTGTCTTGTACTTTGTTGA
rJMFF025B04+ TAAAGTCAAACGCGTTGACACAGTCCGAGCATATACCTTTGGTGTCTTGTACTTTGTTGA
                      ____________________________________________________________
consensus TAAAGTCAAACGCGTTGACACAGTCCGAGCATATACCTTTGGTGTCTTGTACTTTGTTGA
 
. : . : . : . : . : . :
JMSF023H21- GGT
rJMSF033G04+ GGTCGATATTGAACTCCCTGAAGATTTGCCCTTGAAAGAATCTCACACTATAGGAGGGAC
rJMSF023H21+ GGTCGATATTGAACTCCCTGAAGATTTGCCCTTGAAAGAATCTCACACTATAGGAGAGAC
rJMFF025B04+ GGTCGATATTGAACTCCCTGAAGATTTGCCCTTGAAAGAATCTCACACTATAGGAGAGAC
                      ____________________________________________________________
consensus GGTCGATATTGAACTCCCTGAAGATTTGCCCTTGAAAGAATCTCACACTATAGGAGAGAC
 
. : . : . : . : . : . :
rJMSF033G04+ TCTACAGATAAAGATCGAGAAACTCCCTGAAGTAGAACGAGCTTTTGTTCATATTGATTA
rJMSF023H21+ TCTACAGATAAAGATCGAGAAACTCCCTGAAGTAGAACGAGCTTTTGTTCATATTGATTA
rJMFF025B04+ TCTACAGATAAAGATCGAGAAACTCCCTGAAGTAGAACGAGCTTTTGTTCATATTGATTA
                      ____________________________________________________________
consensus TCTACAGATAAAGATCGAGAAACTCCCTGAAGTAGAACGAGCTTTTGTTCATATTGATTA
 
. : . : . : . : . : . :
rJMSF033G04+ CGAATGTGATCACAAACCCGAGCACTCTGTACTCAGCAGGCTGCCCAACACCGAACCATA
rJMSF023H21+ CGAATGTGATCACAAACCCGAGCACTCTGTACTCAGCAGGCTGCCCAACACCGAACCATA
rJMFF025B04+ CGAATGTGATCACAAACCCGAGCACTCTGTACTCAGCAGGCTGCCCAACACCGAACCATA
                      ____________________________________________________________
consensus CGAATGTGATCACAAACCCGAGCACTCTGTACTCAGCAGGCTGCCCAACACCGAACCATA
 
. : . : . : . : . : . :
rJMSF033G04+ ACCTCAACAATCTCAGCATGACACATACTGGCTCCATACAAGTTGTATATTGCCCGGGGA
rJMSF023H21+ ACCTCAACAATCTCAGCATGACACATACTGGCTCCATACAAGTTGTATATTGCCCGGGGA
rJMFF025B04+ ACCTCAACAATCTCAGCATGACACATACTGGCTCCATACAAGTTGTATATTGCCCGGGGA
                      ____________________________________________________________
consensus ACCTCAACAATCTCAGCATGACACATACTGGCTCCATACAAGTTGTATATTGCCCGGGGA
 
. : . : . : . : . : . :
rJMSF033G04+ ACAACCGAACCGAACAAGCTTTCAGGCTGACATCAAGCCCATACAAGTAAAAACTAAAAT
rJMSF023H21+ ACAACCGAACCGAACAAGCTTTCAGGCTGACATCAAGCCCATACAAGTAAAAACTAAAAT
rJMFF025B04+ ACAACCGAACCGAACAAGCTTTCAGGCTGACATCAAGCCCATACAAGTAAAAACTAAAAT
                      ____________________________________________________________
consensus ACAACCGAACCGAACAAGCTTTCAGGCTGACATCAAGCCCATACAAGTAAAAACTAAAAT
 
. : . : . : . : . : . :
rJMSF033G04+ AAGCTTTTGAGCCTTTGGTATATGCATAACTCCCTTTCAACGGGCACCATATTTACCAGC
rJMSF023H21+ AAGCTTTTGAGCCTTTGGTATATGCATAACTCCCTTTCAACGGGCACCATATTTACCAGC
rJMFF025B04+ AAGCTTTTGAGCCTTTGGTATATGCATAACTCCCTTTCAACGGGCACCATATTTACCAGC
                      ____________________________________________________________
consensus AAGCTTTTGAGCCTTTGGTATATGCATAACTCCCTTTCAACGGGCACCATATTTACCAGC
 
. : . : . : . : . : . :
rJMSF033G04+ TTGCTAGAATATGCATTACTGTTATAGTAGTTTACCTGTTCTAAATACAGTATGGATGCA
rJMSF023H21+ TTGCTAGAATATGCATTACTGTTATAGTAGTTTACCTGTTCTAAATACAGTATGGATGCA
rJMFF025B04+ TTGCTAGAATATGCATTACTGTTATAGTAGTTTACCTGTTCTAAATACAGTATGGATGCA
                      ____________________________________________________________
consensus TTGCTAGAATATGCATTACTGTTATAGTAGTTTACCTGTTCTAAATACAGTATGGATGCA
 
. : . : . : . : . : . :
rJMSF033G04+ TAATTTTAGTCATAAGAATGTGTTAAGGCCCGGGCAGACTGAGATCCCGTGACCAGTGGT
rJMSF023H21+ TAATTTTAGTCATAAGAATGTGTTAAGGCCCGGGCAGACTGAGATCCCGTGA-CAGTGGT
rJMFF025B04+ TAATTTTAGTCATAAGAATGTGTTAAGGCCCGGGCAGACTGAGATCCCGTGA-CAGTGGT
                      ____________________________________________________________
consensus TAATTTTAGTCATAAGAATGTGTTAAGGCCCGGGCAGACTGAGATCCCGTGA-CAGTGGT
 
. : . : . : . : . : . :
rJMSF033G04+ GAACAAGCAGGTGGGGGGAGAGTGTCTAAAAGTTTCTCAGAAAAGCTTGTGTATTACATT
rJMSF023H21+ GAACAAGCAGGTGGGGGGAGAGTGTCTAAAAGTTTCTCAGAAAA-CTTGTGTATTACATT
rJMFF025B04+ GAACAAGCAGGTGGGGGGAGAGTGTCTAAAAGTTTCTCAGAAAA-CTTGTGTATTACATT
                      ____________________________________________________________
consensus GAACAAGCAGGTGGGGGGAGAGTGTCTAAAAGTTTCTCAGAAAA-CTTGTGTATTACATT
 
. : . : . : . : . : . :
rJMSF033G04+ TCCTGAATCCTGAGACCACT
rJMSF023H21+ TCCTGAATCCTGAGACCACTGTTTAAATAAACTTTGGGGGAAAGGAATTGCACCCCAACC
rJMFF025B04+ TCCTGAATCCTGAGACCACTGTTTAAATAAACTTTGGGGGAAAGGAATTGCACCCCAACC
                      ____________________________________________________________
consensus TCCTGAATCCTGAGACCACTGTTTAAATAAACTTTGGGGGAAAGGAATTGCACCCCAACC
 
. : . : . : . : . : . :
rJMSF023H21+ AAACATGCTGT
rJMFF025B04+ AAACATGCTGTTATGGATTTGGTTGGTTGTGATTTGAATTAGTATAAAAAACAAACAAAA
                      ____________________________________________________________
consensus AAACATGCTGTTATGGATTTGGTTGGTTGTGATTTGAATTAGTATAAAAAACAAACAAAA