Previous Contig 009374:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025A14Sequence466009374 (2)gb:AK040395_11656290.002Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clon669009374 (2)gb:AK040395_11656290.035Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clon

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF025A14- GTATATTTAT
rJMFF025A14+ GTATATTTAT
                      ____________________________________________________________
consensus GTATATTTAT
 
. : . : . : . : . : . :
JMFF025A14- GTGTGTGTGTATATATAATCGGAGATTCGGAGGTATATCGTAAAGGAGATCGGAAAATTA
rJMFF025A14+ GTGTGTGTGTATATATAATCGGAGATTCGGAGGTATATCGTAAAGGAGATCGGAAAATTA
                      ____________________________________________________________
consensus GTGTGTGTGTATATATAATCGGAGATTCGGAGGTATATCGTAAAGGAGATCGGAAAATTA
 
. : . : . : . : . : . :
JMFF025A14- AATCGGCAGGGAAAGATGATGAACGACGGAACGTTATTGATGTGTCTGGTTTCTTCGTGT
rJMFF025A14+ AATCGGCAGGGAAAGATGATGAACGACGGAACGTTATTGATGTGTCTGGTTTCTTCGTGT
                      ____________________________________________________________
consensus AATCGGCAGGGAAAGATGATGAACGACGGAACGTTATTGATGTGTCTGGTTTCTTCGTGT
 
. : . : . : . : . : . :
JMFF025A14- TCGAGGCCACCGGTGATTCGTCGGAGGTTCAGTCTTCGGTACTCAACGAGGATTCGGCGG
rJMFF025A14+ TCGAGGCCACCGGTGATTCGTCGGAGGTTCAGTCTTCGGTACTCAACGAGGATTCGGCGG
                      ____________________________________________________________
consensus TCGAGGCCACCGGTGATTCGTCGGAGGTTCAGTCTTCGGTACTCAACGAGGATTCGGCGG
 
. : . : . : . : . : . :
JMFF025A14- ATCATGAATGGGGCGACGACGATGCACAGTCGTGCAGCGGTCGTGTTTTTCGGGGAGGTC
rJMFF025A14+ ATCATGAATGGGGCGACGACGATGCACAGTCGTGCAGCGGTCGTG-TTTTCGGGGAGGTC
                      ____________________________________________________________
consensus ATCATGAATGGGGCGACGACGATGCACAGTCGTGCAGCGGTCGTGTTTTTCGGGGAGGTC
 
. : . : . : . : . : . :
JMFF025A14- GATGATGATGCCGGGAGTGACGACGAGGTTAAACGCGTTTCGAGCTGTTTAAGGTTCGAG
rJMFF025A14+ GATGATGATGCCGGGAGTGACGACGAGGTTAAACGCGTTTCGAGCTGTTTAAGGTTCGAG
                      ____________________________________________________________
consensus GATGATGATGCCGGGAGTGACGACGAGGTTAAACGCGTTTCGAGCTGTTTAAGGTTCGAG
 
. : . : . : . : . : . :
JMFF025A14- GAAAATTACGAGTACGGCGATGACATTTGCGACGGCGCAGGCGGCGGCAATGAGACGGAG
rJMFF025A14+ GAAAATTACGAGTACGGCGATGACATTTGCGACGGCGCAGGCGGCGGCAATGAGACGGAG
                      ____________________________________________________________
consensus GAAAATTACGAGTACGGCGATGACATTTGCGACGGCGCAGGCGGCGGCAATGAGACGGAG
 
. : . : . : . : . : . :
JMFF025A14- GAGGACGATTTGGACGGTGAAGATGAAGAAGAAGAAGAGGTGAATCAAGGGTGGATATTG
rJMFF025A14+ GAGGACGATTTGGACGGTGAAGATGAAGAAGAAGAAGAGGTGAATCAAGGGTGGATATTG
                      ____________________________________________________________
consensus GAGGACGATTTGGACGGTGAAGATGAAGAAGAAGAAGAGGTGAATCAAGGGTGGATATTG
 
. : . : . : . : . : . :
JMFF025A14- AGGGGAAAGAAATTGATGAGGCCGTTGGGAGTTGTG
rJMFF025A14+ AGGGGAAAGAAATTGATGAGGCCGTTGGGAGTTGTGAGGACGACAAGGAGGATTAAAGCT
                      ____________________________________________________________
consensus AGGGGAAAGAAATTGATGAGGCCGTTGGGAGTTGTGAGGACGACAAGGAGGATTAAAGCT
 
. : . : . : . : . : . :
rJMFF025A14+ AAGAAATCGAAGGTGTGTAATTTAGAGATGATGAGTGAAAAGGACAGAGATAGGCTATTC
                      ____________________________________________________________
consensus AAGAAATCGAAGGTGTGTAATTTAGAGATGATGAGTGAAAAGGACAGAGATAGGCTATTC
 
. : . : . : . : . : . :
rJMFF025A14+ TGGGAAGCATGTTTATCATAATCGTAATTCCTAACTCTCAATACTTAATTTCTTCAAGTT
                      ____________________________________________________________
consensus TGGGAAGCATGTTTATCATAATCGTAATTCCTAACTCTCAATACTTAATTTCTTCAAGTT
 
. : . : . : . : . : . :
rJMFF025A14+ AGTATTCAATCTTAATGTTATCTCATAATGTTTTAGTATGATGAATATGGTACGAGAATT
                      ____________________________________________________________
consensus AGTATTCAATCTTAATGTTATCTCATAATGTTTTAGTATGATGAATATGGTACGAGAATT