Previous Contig 009365:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024M05Sequence485014575gb:AF348333_17900842e-22Glycine max candidate plant disease resistance protein gene, partial cds.748009365 (3)pir|T05606|T056066e-70protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara
JMSF037I22Sequence657009365 (3)gb:AP001800_18214171e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P044637009365 (3)pir|T05606|T056061e-66protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037I22- CGTAGATTCCATGGTTCAG
                      ____________________________________________________________
consensus CGTAGATTCCATGGTTCAG
 
. : . : . : . : . : . :
JMSF037I22- CTTTTTCTGGTAATCATCTTTCTCCAGTTCCTATTTTTATTTCTCCCAGTGCTTCACCAA
                      ____________________________________________________________
consensus CTTTTTCTGGTAATCATCTTTCTCCAGTTCCTATTTTTATTTCTCCCAGTGCTTCACCAA
 
. : . : . : . : . : . :
JMSF037I22- AACATAAGTCCAGAAAGCTTAGTCAATCTGCAATGCTGGGAATTGTGATTGGAGGTTGTG
                      ____________________________________________________________
consensus AACATAAGTCCAGAAAGCTTAGTCAATCTGCAATGCTGGGAATTGTGATTGGAGGTTGTG
 
. : . : . : . : . : . :
JMSF037I22- CTTTGGGGTTTCTTGTAATCGCGGTCCCGTTCATTCTTTGCTATTCAAAGAAAGAAGATA
                      ____________________________________________________________
consensus CTTTGGGGTTTCTTGTAATCGCGGTCCCGTTCATTCTTTGCTATTCAAAGAAAGAAGATA
 
. : . : . : . : . : . :
JMSF037I22- AAAGTTTGGCCTCACCAAACTCGCTTAGAAAAAGTGGTTCTCTCGGGAAGGCAGCTTTTG
                      ____________________________________________________________
consensus AAAGTTTGGCCTCACCAAACTCGCTTAGAAAAAGTGGTTCTCTCGGGAAGGCAGCTTTTG
 
. : . : . : . : . : . :
JMSF037I22- GCAGTACGGATGGAGGTGGTAACATGGTATTCTTTGAAGGCTGTCATCTTGCCTTTGATC
                      ____________________________________________________________
consensus GCAGTACGGATGGAGGTGGTAACATGGTATTCTTTGAAGGCTGTCATCTTGCCTTTGATC
 
. : . : . : . : . : . :
JMSF037I22- TCGAAGATTTGTTGAGAGCTTCTGCAGAGATCCTAGGGAAAGGGGCATCTGGGGTTGTGT
                      ____________________________________________________________
consensus TCGAAGATTTGTTGAGAGCTTCTGCAGAGATCCTAGGGAAAGGGGCATCTGGGGTTGTGT
 
. : . : . : . : . : . :
JMSF037I22- ATAAGGCAGCTTTGGAGGATGCAACCACGGTTGTGGTGAAGAGATTGAAGGAAGTGAGTG
                      ____________________________________________________________
consensus ATAAGGCAGCTTTGGAGGATGCAACCACGGTTGTGGTGAAGAGATTGAAGGAAGTGAGTG
 
. : . : . : . : . : . :
JMSF037I22- TCGGGAGAAAAGAATTCGAGCAACATTTGGAGGTTGTCGGTAACATTAGGCACGAGAATG
                      ____________________________________________________________
consensus TCGGGAGAAAAGAATTCGAGCAACATTTGGAGGTTGTCGGTAACATTAGGCACGAGAATG
 
. : . : . : . : . : . :
JMSF037I22- TGGCTCCTTTGCGGGCGTACTTCTACTCCAAGGATGAAAAGCTCATGGTGTACGATTATT
rJMFF024M05+ AAGGATGAAAAGCTCATGGTGTACGATTATT
                      ____________________________________________________________
consensus TGGCTCCTTTGCGGGCGTACTTCTACTCCAAGGATGAAAAGCTCATGGTGTACGATTATT
 
. : . : . : . : . : . :
JMSF037I22- ACAGCCAGGGTAGTGTATCAGCAATGCTGCATGATATCAGGCGTGAGAGGCGGTCTCCTT
rJMFF024M05+ ACAGCCAGGGTAGTGTATCAGCAATGCTGCATGATATCAGGCGTGAGAGGCGGTCTCCTT
                      ____________________________________________________________
consensus ACAGCCAGGGTAGTGTATCAGCAATGCTGCATGATATCAGGCGTGAGAGGCGGTCTCCTT
 
. : . : . : . : . : . :
JMSF037I22- TAGATTGGGAAACACGTGTGCAAATTGCGGTCGGTGC
rJMSF037I22+ CGTGTGCAAATTGCGGTCGGTGCAGCAAGAGGCATTGCCTACATCC
rJMFF024M05+ TAGATTGGGAAACACGTGTGCAAATTGCGGTCGGTGC-GCAAGAGGCATTGCCTACATCC
                      ____________________________________________________________
consensus TAGATTGGGAAACACGTGTGCAAATTGCGGTCGGTGCAGCAAGAGGCATTGCCTACATCC
 
. : . : . : . : . : . :
rJMSF037I22+ ACAGACAAAGCGGGGGGAGGCTTGTTCATGGGAATATCAAATCATCGAACATATTCCTCA
rJMFF024M05+ ACAGACAAAGCGGGGGGAGGCTTGTTCATGGGAATATC-AATCATCGAACATATTCCTCA
                      ____________________________________________________________
consensus ACAGACAAAGCGGGGGGAGGCTTGTTCATGGGAATATCAAATCATCGAACATATTCCTCA
 
. : . : . : . : . : . :
rJMSF037I22+ ACTCCCAACACTACGGTTGTGTCTCTGATCTCGGCCTGGCAACGCTAATAGCTCCCATGT
rJMFF024M05+ ACTCCCAACACTACGGTTGTGTCTCTGATCTCGGCCTGGCAACGCTAATAGCTCCCATGT
                      ____________________________________________________________
consensus ACTCCCAACACTACGGTTGTGTCTCTGATCTCGGCCTGGCAACGCTAATAGCTCCCATGT
 
. : . : . : . : . : . :
rJMSF037I22+ CTGCCCCTCTCGCTCAAACTGCAGGGTACTGTCCCCCCGAGGTTACAGACACGAGGAAAG
rJMFF024M05+ CTGCCCCTCTCGCTCAAACTGCAGGGTACTGTCCCCCCGAGGTTACAGACACGAGGAAAG
                      ____________________________________________________________
consensus CTGCCCCTCTCGCTCAAACTGCAGGGTACTGTCCCCCCGAGGTTACAGACACGAGGAAAG
 
. : . : . : . : . : . :
rJMSF037I22+ CCACCCAGGCATCNGACGTNTACAGCTTTGGGGTCTTGCTGCTCGAACTCCTAACGGGAA
rJMFF024M05+ CCACCCAGGCATCCGACGTCTACAGCTTTGGGGTCTTGCTGCTCGAACTCCTAACGGGAA
                      ____________________________________________________________
consensus CCACCCAGGCATCCGACGTCTACAGCTTTGGGGTCTTGCTGCTCGAACTCCTAACGGGAA
 
. : . : . : . : . : . :
rJMSF037I22+ AATCCCCGATGCATGCCACAGGGGGGGACGAGTTTGTGCACATAGTAAGATGGGTGCACT
rJMFF024M05+ AATCCCCGATGCATGCCACAGGGGGGGACGAGTTTGTGCACATAGTAAGATGGGTGCACT
                      ____________________________________________________________
consensus AATCCCCGATGCATGCCACAGGGGGGGACGAGTTTGTGCACATAGTAAGATGGGTGCACT
 
. : . : . : . : . : . :
rJMSF037I22+ CTGTGGTTCGCGAGGAGTGGACTGCGGAAGTGTTTGATATCGTGCTTTTGCGGTCTCCCA
rJMFF024M05+ CTGTGGTTCGCGAGGAGTGGACTGCGGAAGTGTTTGATATCGTGCTTTTGCGGTCTCCCA
                      ____________________________________________________________
consensus CTGTGGTTCGCGAGGAGTGGACTGCGGAAGTGTTTGATATCGTGCTTTTGCGGTCTCCCA
 
. : . : . : . : . : . :
rJMSF037I22+ ACATCGAGGAAGAGATGGTGGAGATGCTGCAAATCGGGATGAACTGNGTAGCCAGATTGC
rJMFF024M05+ ACATCGAGGAAGAGATGGTGGAGATGCTGCAAATCGGGATGAACTGCGTAGCCAGATTGC
                      ____________________________________________________________
consensus ACATCGAGGAAGAGATGGTGGAGATGCTGCAAATCGGGATGAACTGCGTAGCCAGATTGC
 
. : . : . : . : . : . :
rJMSF037I22+ CGGATCAGCGGCCGAGAATGGCAGAAGTAGTGAAGATGGTGGAGGGCATTAGAAAGATGA
rJMFF024M05+ CGGATCAGCGGCCGAGAATGGCAGAAGTAGTGAAGATGGTGGAGGGCATTAGAAAGATGA
                      ____________________________________________________________
consensus CGGATCAGCGGCCGAGAATGGCAGAAGTAGTGAAGATGGTGGAGGGCATTAGAAAGATGA
 
. : . : . : . : . : . :
rJMSF037I22+ ATTCTGGAAATCAGACAGAAAGCTCAACTCCAACTCTTCACACTCCTCCCATACTTGAAA
rJMFF024M05+ ATTCTGGAAATCAGACAGAAAGCTCAACTCCAACTCTTCACACTCCTCCCATACTTGAAA
                      ____________________________________________________________
consensus ATTCTGGAAATCAGACAGAAAGCTCAACTCCAACTCTTCACACTCCTCCCATACTTGAAA
 
. : . : . : . : . : . :
rJMSF037I22+ TAGGGTCTTCATATCCACATTGAGTTTATGTTTCATANCTGTGTATAAACT
rJMFF024M05+ TAGGGTCTTCATATCCACATTGAGTTTATGTTTCATA-CTGTGTATAAACTTGTAATTTT
                      ____________________________________________________________
consensus TAGGGTCTTCATATCCACATTGAGTTTATGTTTCATANCTGTGTATAAACTTGTAATTTT