Previous Contig 009361:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024K23Sequence462003573 (3)pir|T48587|T485878e-54peptide transporter-like protein - Arabidopsis thaliana>gb:ATT22N19_1555307 Arab624009361 (4)pir|T48587|T485871e-42peptide transporter-like protein - Arabidopsis thaliana>gb:ATT22N19_1555307 Arab
JMFN007M06Sequence615009361 (4)pir|T48587|T485875e-82peptide transporter-like protein - Arabidopsis thaliana>gb:ATT22N19_1555307 Arab
JMFN031L05Sequence623009361 (4)pir|T48587|T485874e-80peptide transporter-like protein - Arabidopsis thaliana>gb:ATT22N19_1555307 Arab
JMSF050L22Sequence577004819 (3)613009361 (4)pir|T48587|T485873e-54peptide transporter-like protein - Arabidopsis thaliana>gb:ATT22N19_1555307 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN031L05- ACCATAATGCTAAC
JMFN007M06- CTAAC
                      ____________________________________________________________
consensus ACCATAATGCTAAC
 
. : . : . : . : . : . :
JMFN031L05- GCTAATCCTAGTGGAGTTTCTAACCCTCTCCGTCCAGCAAGCATACACGCTCAACACACA
JMFN007M06- GCTAATCCTAGTGGAGTTTCTAACCCTCTCCGTCCAGCAAGCATACACGCTCAACACACA
                      ____________________________________________________________
consensus GCTAATCCTAGTGGAGTTTCTAACCCTCTCCGTCCAGCAAGCATACACGCTCAACACACA
 
. : . : . : . : . : . :
JMFN031L05- CATCGGCCGCCTCAAACTTCCGGTGACCTGCATGCCCGTCTTCCCCGGCCTCAGCATCTT
JMFN007M06- CATCGGCCGCCTCAAACTTCCGGTGACCTGCATGCCCGTCTTCCCCGGCCTCAGCATCTT
                      ____________________________________________________________
consensus CATCGGCCGCCTCAAACTTCCGGTGACCTGCATGCCCGTCTTCCCCGGCCTCAGCATCTT
 
. : . : . : . : . : . :
JMFN031L05- CCTCCTCTTCTCTCTCTACTACTCCGTCTTTGTACCCCTCTCCCGCCGCATCACCGGCCA
JMFN007M06- CCTCCTCTTCTCTCTCTACTACTCCGTCTTTGTACCCCTCTCCCGCCGCATCACCGGCCA
                      ____________________________________________________________
consensus CCTCCTCTTCTCTCTCTACTACTCCGTCTTTGTACCCCTCTCCCGCCGCATCACCGGCCA
 
. : . : . : . : . : . :
JMFN031L05- CCCTCACGGCGCCTCCCAGCTCCAGAGGGTCGGCATCGGTTTAGCCGTTTCCATCGCCTC
JMFN007M06- CCCTCACGGCGCCTCCCAGCTCCAGAGGGTCGGCATCGGTTTAGCCGTTTCCATCGCCTC
                      ____________________________________________________________
consensus CCCTCACGGCGCCTCCCAGCTCCAGAGGGTCGGCATCGGTTTAGCCGTTTCCATCGCCTC
 
. : . : . : . : . : . :
JMFN031L05- GGTGGCCTGGGCCGGCGTCTTCGAAAGGTACCGGAGAAACTACGCGATTAAACACGGGTA
JMFN007M06- GGTGGCCTGGGCCGGCGTCTTCGAAAGGTACCGGAGAAACTACGCGATTAAACACGGGTA
rJMSF050L22+ TCTTCGAAAGGTACCGGAGAAACTACGCGATTAAACACGGGTA
                      ____________________________________________________________
consensus GGTGGCCTGGGCCGGCGTCTTCGAAAGGTACCGGAGAAACTACGCGATTAAACACGGGTA
 
. : . : . : . : . : . :
JMFN031L05- TGAAGCGAGTTTCTTGACGGCAATGCCGGAGCTGAGCGCGTACTGGCTGCTGATTCAGTA
JMFN007M06- TGAAGCGAGTTTCTTGACGGCAATGCCGGAGCTGAGCGCGTACTGGCTGCTGATTCAGTA
rJMSF050L22+ TGAAGCGAGTTTCTTGACGGCAATGCCGGAGCTGAGCGCGTACTGGCTGCTGATTCAGTA
rJMFF024K23+ GCGCGTACTGGCTGCTGATTCAGTA
                      ____________________________________________________________
consensus TGAAGCGAGTTTCTTGACGGCAATGCCGGAGCTGAGCGCGTACTGGCTGCTGATTCAGTA
 
. : . : . : . : . : . :
JMFN031L05- CTGTCTGATAGGGATCGCAGAGGTGTTCTGCATAGTGGGATTGCTGGAGTTTCTATACGA
JMFN007M06- CTGTCTGATAGGGATCTCAGAGGTATTCTGCATAGTGGGATTGCTGGAGTTTCTATACGA
rJMSF050L22+ CTGTCTGATAGGGATCGCAGAGGTGTTCTGCATAGTGGGATTGCTGGAGTTTCTATACGA
rJMFF024K23+ CTGTCTGATAGGGATCGCAGAGGTGTTNTGCATAGTGGGATTGCTGGAGTTTTTATACGA
                      ____________________________________________________________
consensus CTGTCTGATAGGGATCGCAGAGGTGTTCTGCATAGTGGGATTGCTGGAGTTTCTATACGA
 
. : . : . : . : . : . :
JMFN031L05- GGAAGCGCCGGACGCGATGAGAAGCATAGGGTCGGCTTACGCCGCCGTGGCCGGCGGTCT
JMFN007M06- GGAAGCGCCGGACGCGATGAGAAGCATAGGGTCGGCTTACGCCGCCGTGGCCGGCGGTCT
rJMSF050L22+ GGAAGCGCCGGACGCGATGAGAAGCATAGGGTCGGCTTACGCCGCCGTGGCCGGCGGTCT
rJMFF024K23+ GGAAGCGCCGGACGCGATGAGAAGCATAGGGTCGGCTTACGCCGCCGTGGCCGGCGGTCT
                      ____________________________________________________________
consensus GGAAGCGCCGGACGCGATGAGAAGCATAGGGTCGGCTTACGCCGCCGTGGCCGGCGGTCT
 
. : . : . : . : . : . :
JMFN031L05- GGGGTGCTTTGCGGCCACAATACTGAACAGCATTGTGAAAGGCGTAACCGGCGGGAAGGA
JMFN007M06- GGGGTGCTTTGCGGCCACAATACTGAACAGCATTGTGAAAGGCGTAACCGGCGGGAAGGA
rJMSF050L22+ GGGGTGCTTTGCGGCCACAATACTGAACAGCATTGTGAAAGGCGTAACCGGCGGGAAGGA
rJMFF024K23+ GGGGTGCTTTGCGGCCACAATACTGAACAGCATTGTGAAAGGCGTAACCGGCGGGAAGGA
                      ____________________________________________________________
consensus GGGGTGCTTTGCGGCCACAATACTGAACAGCATTGTGAAAGGCGTAACCGGCGGGAAGGA
 
. : . : . : . : . : . :
JMFN031L05- AGA-GAANGGCGACAGTCGTGGCTGTCTCAAAATGTNNAATACGGACGATTCGACTACCT
JMFN007M06- AGAGGAAGGGCGACAGTCGTGGCTGTCTCAGAATGTANATACCGGACGATTCGACTACCT
rJMSF050L22+ AGAGGAAGGGCGACAGTCGTGGCTGTCTCAGAATGTAAATACCGGACGATTCGACTACCT
rJMFF024K23+ AGAGGAAGGGCGACAGTCGTGGCTGTCTCAGAATGTAAATACCGGACGATTCGACTACCT
                      ____________________________________________________________
consensus AGAGGAAGGGCGACAGTCGTGGCTGTCTCAGAATGTAAATACCGGACGATTCGACTACCT
 
. : . : . : . : . : . :
JMFN031L05- TTACTGGCTG
JMFN007M06- TTACTGGCTG
rJMSF050L22+ TTACTGGCTGTTAACGTTGCTGAGTGTGGTCAATTTCTGCGGTTTTGTGTACGCCGCCCG
rJMFF024K23+ TTACTGGCTGTTAACGTTGCTGAGTGTGGTCAATTTCTGCGGTTTTGTGTACGCCGCCCG
                      ____________________________________________________________
consensus TTACTGGCTGTTAACGTTGCTGAGTGTGGTCAATTTCTGCGGTTTTGTGTACGCCGCCCG
 
. : . : . : . : . : . :
rJMSF050L22+ CCGGTATCAGTACCGGAAGAAGCCCGGAGCTGAGACGGACCTGCCGGCGGCGAAAACTGA
rJMFF024K23+ CCGGTATCAGTACCGGAAGAAGCCCGGAGCTGAGACGGACCTGCCGGCGGCGAAAACTGA
                      ____________________________________________________________
consensus CCGGTATCAGTACCGGAAGAAGCCCGGAGCTGAGACGGACCTGCCGGCGGCGAAAACTGA
 
. : . : . : . : . : . :
rJMSF050L22+ GCTACAAGCCGTAGCAGAGTGAAGNTGCGTTGAATTCTTTTTGGATTTGTTTGCTTATAC
rJMFF024K23+ GCTACAAGCCGTAGCAGAGTGAAGCTGCGTTGAATTCTTTTTGGATTTGTTTGCTTATAC
                      ____________________________________________________________
consensus GCTACAAGCCGTAGCAGAGTGAAGCTGCGTTGAATTCTTTTTGGATTTGTTTGCTTATAC
 
. : . : . : . : . : . :
rJMSF050L22+ CTTTCGATTTTAATTACACCAAATTAAAAGCATTTTGGATTTCCATAGAAATGGACCTCA
rJMFF024K23+ CTTTCGATTTTAATTACACCAAATTAAAAGCATTTTGGATTTCCATAGAAATGGACCTCA
                      ____________________________________________________________
consensus CTTTCGATTTTAATTACACCAAATTAAAAGCATTTTGGATTTCCATAGAAATGGACCTCA
 
. : . : . : . : . : . :
rJMSF050L22+ CATGTAACCATGTTGATGTTCTGCATTAAT
rJMFF024K23+ CATGTAA-CATGTTGATGTTCTGCATTAATGTGAACCAGCTATCATTCCTACTCATTATC
                      ____________________________________________________________
consensus CATGTAACCATGTTGATGTTCTGCATTAATGTGAACCAGCTATCATTCCTACTCATTATC
 
. : . : . : . : . : . :
rJMFF024K23+ ATGCATGTTTATTGTATTAACATTGGGGGATTTTTGGTAAATAGCTAGCTGATTGAGTTA
                      ____________________________________________________________
consensus ATGCATGTTTATTGTATTAACATTGGGGGATTTTTGGTAAATAGCTAGCTGATTGAGTTA