Previous Contig 009360:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016I22Sequence579006654 (4)gb:AY029317_15592262e-26Zea mays seven transmembrane protein Mlo6 mRNA, complete cds.726009360 (3)gb:AF369566_17919342e-49Arabidopsis thaliana membrane protein Mlo5 mRNA, complete cds.
JMFF024K01Sequence509006654 (4)gb:AY029317_15592261e-26Zea mays seven transmembrane protein Mlo6 mRNA, complete cds.752009360 (3)gb:AF369566_17919341e-52Arabidopsis thaliana membrane protein Mlo5 mRNA, complete cds.
JMSF014D10Sequence207006654 (4)807009360 (3)gb:AC135431_17424152e-60Oryza sativa (japonica cultivar-group) chromosome 5 clone P0683B12, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014D10+ CTGCAGTGCTGTATTTGCTGCTGAATGTGAATGGATGGCAAACAATGT
                      ____________________________________________________________
consensus CTGCAGTGCTGTATTTGCTGCTGAATGTGAATGGATGGCAAACAATGT
 
. : . : . : . : . : . :
rJMSF014D10+ TATGGCTATCTATACTACCTTTCATTACACTGTTAGTAGTTGGTACAAAGCTTCAAGCAA
rJMFF016I22+ TCAAGCAA
rJMFF024K01+ CACTGTTAGTAGTTGGTACAAAGCTTCAAGCAA
                      ____________________________________________________________
consensus TATGGCTATCTATACTACCTTTCATTACACTGTTAGTAGTTGGTACAAAGCTTCAAGCAA
 
. : . : . : . : . : . :
rJMSF014D10+ TTATAACACAAATGGCGATTGAGATTGAACAAAGGCATGATGTAGTTCAGGGCATACCAC
rJMFF016I22+ TTATAACACAAATGGCGATTGAGATTGAACAAAGGCATGATGTAGTTCAGGGCATACCAC
rJMFF024K01+ TTATAACACAAATGGCGATTGAGATTGAACAAAGGCATGATGTAGTTCAGGGCATACCAC
                      ____________________________________________________________
consensus TTATAACACAAATGGCGATTGAGATTGAACAAAGGCATGATGTAGTTCAGGGCATACCAC
 
. : . : . : . : . : . :
rJMSF014D10+ TGGTGCAAGTCTCAGACACATATTTTTGGTTTAGCAGACCAAAGTTAGTCCTTCATCTTA
rJMFF016I22+ TGGTGCAAGTCTCAGACACATATTTTTGGTTTAGCAGACCAAAGTTAGTCCTTCATCTTA
rJMFF024K01+ TGGTGCAAGTCTCAGACACATATTTTTGGTTTAGCAGACCAAAGTTAGTCCTTCATCTTA
                      ____________________________________________________________
consensus TGGTGCAAGTCTCAGACACATATTTTTGGTTTAGCAGACCAAAGTTAGTCCTTCATCTTA
 
. : . : . : . : . : . :
rJMSF014D10+ TCCATCTCACCCTTTTTCAGAATGCGTTTGACATAACATATTTCCTCTGGAATTCGTATG
rJMFF016I22+ TCCATCTCACCCTTTTTCAGAATGCGTTTGACATAACATATTTCCTCTGGAATTCGTATG
rJMFF024K01+ TCCATCTCACCCTTTTTCAGAATGCGTTTGACATAACATATTTCCTCTGGAATTCGTATG
                      ____________________________________________________________
consensus TCCATCTCACCCTTTTTCAGAATGCGTTTGACATAACATATTTCCTCTGGAATTCGTATG
 
. : . : . : . : . : . :
rJMSF014D10+ AGTTTGGATCAGATTCTTGCTTTCACGAAAGCTTCCATCTCGCCATGGCCAGAGTGGCAT
rJMFF016I22+ AGTTTGGATCAGATTCTTGCTTTCACGAAAGCTTCCATCTCGCCATGGCCAGAGTGGCAT
rJMFF024K01+ AGTTTGGATCAGATTCTTGCTTTCACGAAAGCTTCCATCTCGCCATGGCCAGAGTGGCAT
                      ____________________________________________________________
consensus AGTTTGGATCAGATTCTTGCTTTCACGAAAGCTTCCATCTCGCCATGGCCAGAGTGGCAT
 
. : . : . : . : . : . :
rJMSF014D10+ TCGGGATTGGGGTACAGTTCATGTGCAGCTACATTACGCTTCCACTATATGCGCTCGTCA
rJMFF016I22+ TCGGGATTGGGGTACAGTTCATGTGCAGCTACATTACGCTTCCACTATATGCGCTCGTCA
rJMFF024K01+ TCGGGATTGGGGTACAGTTCATGTGCAGCTACATTACGCTTCCACTATATGCGCTCGTCA
                      ____________________________________________________________
consensus TCGGGATTGGGGTACAGTTCATGTGCAGCTACATTACGCTTCCACTATATGCGCTCGTCA
 
. : . : . : . : . : . :
rJMSF014D10+ CCCAGATGGGTTCTAGTATGAAGCAGTCCATTTTTGATGAACACACTTCAAAAGCCCTGA
rJMFF016I22+ CCCAGATGGGTTCTAGTATGAAGCAGTCCATTTTTGATGAACACACTTCAAAAGCCCTGA
rJMFF024K01+ CCCAGATGGGTTCTAGTATGAAGCAGTCCATTTTTGATGAACACACTTCAAAAGCCCTGA
                      ____________________________________________________________
consensus CCCAGATGGGTTCTAGTATGAAGCAGTCCATTTTTGATGAACACACTTCAAAAGCCCTGA
 
. : . : . : . : . : . :
rJMSF014D10+ TGAACTGGCGCAAGAAGGTGCAGCACAAGAACCACGACCACCACGACCATGTGACGGGGC
rJMFF016I22+ TGAACTGGCGCAAGAAGGTGCAGCACAAGAACCACGACCACCACGACCATGTGACGGGGC
rJMFF024K01+ TGAACTGGCGCAAGAAGGTGCAGCACAAGAACCACGACCACCACGACCATGTGACGGGGC
                      ____________________________________________________________
consensus TGAACTGGCGCAAGAAGGTGCAGCACAAGAACCACGACCACCACGACCATGTGACGGGGC
 
. : . : . : . : . : . :
rJMSF014D10+ TGCAGCAAGGAAAGTTGGGAGGCAGCAGCTCCAGTGATTTACCAGACACGTCGGCAGCTG
rJMFF016I22+ TGCAGCAAGGAAAGTTGGGAGGCAGCAGCTCCAGTGATTTACCAGACACGTCGGCAGCTG
rJMFF024K01+ TGCAGCAAGGAAAGTTGGGAGGCAGCAGCTCCAGTGATTTACCAGACACGTCGGCAGCTG
                      ____________________________________________________________
consensus TGCAGCAAGGAAAGTTGGGAGGCAGCAGCTCCAGTGATTTACCAGACACGTCGGCAGCTG
 
. : . : . : . : . : . :
rJMSF014D10+ GGCAATGTTCCATAGATAATGATGGTCATGATTATTTCTCTTCTGCTTCAAGACACACCA
rJMFF016I22+ GGCAATGTTCCATAGATAATGATGATCATGATTATTTCTCTTCTGCTTCAAGACACACCA
rJMFF024K01+ GGCAATGTTCCATAGATAATGATGATCATGATTATTTCTCTTCTGCTTCAAGACACACCA
                      ____________________________________________________________
consensus GGCAATGTTCCATAGATAATGATGATCATGATTATTTCTCTTCTGCTTCAAGACACACCA
 
. : . : . : . : . : . :
rJMSF014D10+ TAGAAATTCGCGATGATCAGCAGCAGGATGAGGAAAATAGTGATGACGATGATGATTCTA
rJMFF016I22+ TAGAAATTCGCGATGATCAGCAGCAGGATGAGGAAAATAGTGATGACGATGATGATTCTA
rJMFF024K01+ TAGAAATTCGCGATGATCAGCAGCAGGATGAGGAAAATAGTGATGACGATGATGATTCTA
                      ____________________________________________________________
consensus TAGAAATTCGCGATGATCAGCAGCAGGATGAGGAAAATAGTGATGACGATGATGATTCTA
 
. : . : . : . : . : . :
rJMSF014D10+ AGCTCGATAATAATATTGACCTTCTTACACCTCCTTAATTCATTCATAATATAATGTTCT
rJMFF016I22+ AGCTCGATAATAATATTGACCTTCTTACACCTCCTTAATTCATTCATAATATAATGTTCT
rJMFF024K01+ AGCTCGATAATAATATTGACCTTCTTACACCTCCTTAATTCATTCATAATATAATGTTCT
                      ____________________________________________________________
consensus AGCTCGATAATAATATTGACCTTCTTACACCTCCTTAATTCATTCATAATATAATGTTCT
 
. : . : . : . : . : . :
rJMSF014D10+ GATTGATCTGTTAAAATGGTCATACATACCAAGCATTAA
rJMFF016I22+ GATTGATCTGTTAAAATGGTCATACATA-CAAGCATTAATTGTATTGCATGACTGCAAA
rJMFF024K01+ GATTGATCTGTTAAAATGGTCATACATA-CAAGCATTAATTGTATTGCATGACTGCAAAT
                      ____________________________________________________________
consensus GATTGATCTGTTAAAATGGTCATACATA-CAAGCATTAATTGTATTGCATGACTGCAAAT