Previous Contig 009359:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024J24Sequence471004365 (4)781009359 (3)pir|T47721|T477214e-34hypothetical protein F1I16.230 - Arabidopsis thaliana>gb:ATF1I16_1549375 Arabido
JMFF035C24Sequence512004365 (4)776009359 (3)pir|T47721|T477214e-34hypothetical protein F1I16.230 - Arabidopsis thaliana>gb:ATF1I16_1549375 Arabido
JMSF001O20Sequence204004365 (4)733009359 (3)pir|T47721|T477216e-30hypothetical protein F1I16.230 - Arabidopsis thaliana>gb:ATF1I16_1549375 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF024J24+ GT
                      ____________________________________________________________
consensus GT
 
. : . : . : . : . : . :
rJMFF035C24+ CCAGATAATCGATTGNCCGGTTGGCCCCGTTACTGAGAAGACCCAAATTAGGNTCA
rJMFF024J24+ CGGTCCAGATAATCGATTGGCCGGTTGG-CCCGTTACTGAGAAGAACCAAATTAGGGTCA
                      ____________________________________________________________
consensus CGGTCCAGATAATCGATTGGCCGGTTGGCCCCGTTACTGAGAAGACCCAAATTAGGGTCA
 
. : . : . : . : . : . :
rJMFF035C24+ GAAAATGAGGAGAGGTAAGAACACGATAGATCCAGTAAAATTTATGTGCGTACTTGTCTC
rJMFF024J24+ GAAAATGAGGAGAGGTAAGAACACGATAGATCCAGTAAAATTTATGTGCGTACTTGTCTC
                      ____________________________________________________________
consensus GAAAATGAGGAGAGGTAAGAACACGATAGATCCAGTAAAATTTATGTGCGTACTTGTCTC
 
. : . : . : . : . : . :
rJMFF035C24+ TATTGTTTTCACCTTCATTCTATTCATTTCAATCCTCAAAATCCATGAACTTCCATTGAA
rJMSF001O20+ A
rJMFF024J24+ TATTGTTTTCACCTTCATTCTATTCATTTCAATCCTCAAAATCCATGAACTTCCATTGAA
                      ____________________________________________________________
consensus TATTGTTTTCACCTTCATTCTATTCATTTCAATCCTCAAAATCCATGAACTTCCATTGAA
 
. : . : . : . : . : . :
rJMFF035C24+ GAAGGACAATGCAATCCTTTCATGGGGCGGTAAGAAAATCAAGTCGACTTCCAAAGATGC
rJMSF001O20+ GAAGGACAATGCAATCCTTTCATGGGGCGGTAAGAAAATCAAGTCGACTTCCAAAGATGC
rJMFF024J24+ GAAGGACAATGCAATCCTTTCATGGGGCGGTAAGAAAATCAAGTCGACTTCCAAAGATGC
                      ____________________________________________________________
consensus GAAGGACAATGCAATCCTTTCATGGGGCGGTAAGAAAATCAAGTCGACTTCCAAAGATGC
 
. : . : . : . : . : . :
rJMFF035C24+ GAAAGTGGGGAAGTTCGGTGGAATGGTGATTGAGATGTTACCTGAAGATCTGGGGTTCAC
rJMSF001O20+ GAAAGTGGGGAAGTTCGGTGGAATGGTGATTGAGATGTTACCTGAAGATCTGGGGTTCAC
rJMFF024J24+ GAAAGTGGGGAAGTTCGGTGGAATGGTGATTGAGATGTTACCTGAAGATCTGGGGTTCAC
                      ____________________________________________________________
consensus GAAAGTGGGGAAGTTCGGTGGAATGGTGATTGAGATGTTACCTGAAGATCTGGGGTTCAC
 
. : . : . : . : . : . :
rJMFF035C24+ TTTATTTCTACCGTCGGAGGAAGCGTTTGAGCGTAATTTGGGACTGCGGTTAAACGAAAG
rJMSF001O20+ TTTATTTCTACCGTCGGAGGAAGCGTTTGAGCGTGATTTGGGACTGCGGTTAAACGAAAG
rJMFF024J24+ TTTATTTCTACCGTCGGAGGAAGCGTTTGAGCGTAATTTGGGACTGCGGTTAAACGAAAG
                      ____________________________________________________________
consensus TTTATTTCTACCGTCGGAGGAAGCGTTTGAGCGTAATTTGGGACTGCGGTTAAACGAAAG
 
. : . : . : . : . : . :
rJMFF035C24+ CTTGGCGGAGGAGAAGGTGGATGATACTCATGCAGTACTTACTCGCGTGCTGGGGTTTTC
rJMSF001O20+ CTTGGCGGAGGAGAAGGTGGATGATACTCATGCAGTACTTACTCGCGTGCTGGGGTTTTC
rJMFF024J24+ CTTGGCGGAGGAGAAGGTGGATGATACTCATGCAGTACTTACTCGCGTGCTGGGGTTTTC
                      ____________________________________________________________
consensus CTTGGCGGAGGAGAAGGTGGATGATACTCATGCAGTACTTACTCGCGTGCTGGGGTTTTC
 
. : . : . : . : . : . :
rJMFF035C24+ CGCCTTGCCGAGGATCATTCATTTGGAGAATGTGGTTTCTGGGGAGGAGATTAGATATGA
rJMSF001O20+ CGCCTTGCCGAGGATCATTCATTTGGAGAATGTGGTTTCTGGGGAGGAGATTAGATATGA
rJMFF024J24+ CGCCTTGCCGAGGATCATTCATTTGGAGAATGTGGTTTCTGGGGAGGAGATTAGATATGA
                      ____________________________________________________________
consensus CGCCTTGCCGAGGATCATTCATTTGGAGAATGTGGTTTCTGGGGAGGAGATTAGATATGA
 
. : . : . : . : . : . :
rJMFF035C24+ TTCATTGTCTGGTTTCACTTTGTTGATTGTGAAGGATTCGAAGGGTTCATTGGTGGTCAA
rJMSF001O20+ TTCATTGTCTGGTTTCACTTTGTTGATTGTGAAGGATTCGAAGGGTTCATTGGTGGTCAA
rJMFF024J24+ TTCATTGTCTGGTTTCACTTTGTTGATTGTGAAGGATTCGAAGGGTTCATTGGTGGTCAA
                      ____________________________________________________________
consensus TTCATTGTCTGGTTTCACTTTGTTGATTGTGAAGGATTCGAAGGGTTCATTGGTGGTCAA
 
. : . : . : . : . : . :
rJMFF035C24+ TGGAGTCCGATCGGAAATGGTGGATTTAAGGAGAGGGAAGATTGTTGTTCATGTTATGAA
rJMSF001O20+ TGGAGTCCGATCGGAAATGGTGGATTTAAGGAGAGGGAAGATTGTTGTTCATGTTATGAA
rJMFF024J24+ TGGAGTCCGATCGGAAATGGTGGATTTAAGGAGAGGGAAGATTGTTGTTCATGTTATGAA
                      ____________________________________________________________
consensus TGGAGTCCGATCGGAAATGGTGGATTTAAGGAGAGGGAAGATTGTTGTTCATGTTATGAA
 
. : . : . : . : . : . :
rJMFF035C24+ TGGTGTGTTAATGGATGCCGAGTTTGAACAGTCTGTTCGTCCAGATTATAGTGGAGGAGA
rJMSF001O20+ TGGTGTGTTAATGGATGCCGAGTTTGAACAGTCTGTTCGTCCAGATTATAGTGGAGGAGA
rJMFF024J24+ TGGTGTGTTAATGGATGCCGAGTTTGAACAGTCTGTTCGTCCAGATTATAGTGGAGGAGA
                      ____________________________________________________________
consensus TGGTGTGTTAATGGATGCCGAGTTTGAACAGTCTGTTCGTCCAGATTATAGTGGAGGAGA
 
. : . : . : . : . : . :
rJMFF035C24+ TTGATCTTAGTGTAGCTTCTAATGCACTGAAATTTGTTAAAACTCCTTGAAATTGTAGCT
rJMSF001O20+ TTGATCTTAGTGTAGCTTCTAATGCACTGAAATTTGTTAAAACTCCTTGAAATTGTAGCT
rJMFF024J24+ TTGATCTTAGTGTAGCTTCTAATGCACTGAAATTTGTTAAAACTCCTTGAAATTGTAGCT
                      ____________________________________________________________
consensus TTGATCTTAGTGTAGCTTCTAATGCACTGAAATTTGTTAAAACTCCTTGAAATTGTAGCT
 
. : . : . : . : . : . :
rJMFF035C24+ TGTAATGCAAAATGTACAATTGAAACTAAATATTTTCCAGGCTTGTTTATATTGAATGAT
rJMSF001O20+ TGTAATGCAAAATGTACAATTGAAACTAAATATTT
rJMFF024J24+ TGTAATGCAAAATGTACAATTGAAACTAAATATTTTCCAGGCTTGTTTATATTGAATGAT
                      ____________________________________________________________
consensus TGTAATGCAAAATGTACAATTGAAACTAAATATTTTCCAGGCTTGTTTATATTGAATGAT