Previous Contig 009352:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001A20Sequence564006729 (28)gb:AF528526_18085602e-87Glycine max 40S ribosomal S4 protein mRNA, complete cds.530009352 (16)gb:AF528526_18085604e-52Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF008P05Sequence564006729 (28)gb:AF528526_18085606e-82Glycine max 40S ribosomal S4 protein mRNA, complete cds.766009352 (16)gb:AF528526_18085604e-95Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF024I14Sequence414006729 (28)gb:AF528526_18085603e-59Glycine max 40S ribosomal S4 protein mRNA, complete cds.778009352 (16)gb:AF528526_18085609e-68Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF025J24Sequence562006729 (28)gb:AF528526_18085601e-88Glycine max 40S ribosomal S4 protein mRNA, complete cds.755009352 (16)gb:AF528526_18085603e-95Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF026E04Sequence562006729 (28)gb:AF528526_18085601e-88Glycine max 40S ribosomal S4 protein mRNA, complete cds.533009352 (16)gb:AF528526_18085609e-52Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF026E15Sequence599006729 (28)gb:AF528526_18085607e-95Glycine max 40S ribosomal S4 protein mRNA, complete cds.286009352 (16)sp|P46299|RS4_GOSHI1e-1540S ribosomal protein S4.>pir|S45026|S45026 ribosomal protein S4, cytosolic - up
JMFF039L13Sequence317006729 (28)gb:AP004851_18459744e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ13662009352 (16)gb:AF528526_18085602e-66Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF042P10Sequence635006729 (28)gb:AF528526_1808560e-100Glycine max 40S ribosomal S4 protein mRNA, complete cds.600009352 (16)gb:AF528526_18085606e-54Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF047C07Sequence472006729 (28)gb:AY086206_15712611e-69Arabidopsis thaliana clone 22434 mRNA, complete sequence.>gb:AF428285_1799215 Ar386009352 (16)gb:AF528526_18085603e-19Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFS030D03Sequence456009352 (16)gb:AF528526_18085607e-31Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF014G02Sequence255006729 (28)gb:AY086206_15712611e-29Arabidopsis thaliana clone 22434 mRNA, complete sequence.>gb:AF428285_1799215 Ar794009352 (16)gb:AF528526_18085602e-99Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF018E18Sequence525006729 (28)gb:AF528526_18085602e-82Glycine max 40S ribosomal S4 protein mRNA, complete cds.780009352 (16)gb:AF528526_18085603e-93Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF018N08Sequence467006729 (28)gb:AF528526_18085602e-68Glycine max 40S ribosomal S4 protein mRNA, complete cds.767009352 (16)gb:AF528526_18085606e-93Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF031F04Sequence639006729 (28)gb:AF528526_1808560e-100Glycine max 40S ribosomal S4 protein mRNA, complete cds.719009352 (16)gb:AF528526_18085607e-96Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF035H20Sequence638006729 (28)gb:AF528526_1808560e-101Glycine max 40S ribosomal S4 protein mRNA, complete cds.739009352 (16)gb:AF528526_18085604e-91Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF044G19Sequence738006729 (28)gb:AF528526_1808560e-108Glycine max 40S ribosomal S4 protein mRNA, complete cds.641009352 (16)gb:AF528526_18085604e-71Glycine max 40S ribosomal S4 protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF008P05+ AAACAGGTNGAAGTATGCCCTTACCTATCGTGAAGTCATTTCAA
rJMFF025J24+ GAAGTCATTTCAA
rJMSF018N08+ TTCAA
rJMSF031F04+ ATCGTGAAGTCATTTCAA
rJMSF014G02+ AAGTATGCCCTTACCTATCGTGAAGTCATTTCAA
rJMSF018E18+ GAAGTCATTTCAA
                      ____________________________________________________________
consensus AAACAGGTNGAAGTATGCCCTTACCTATCGTGAAGTCATTTCAA
 
. : . : . : . : . : . :
rJMFF008P05+ TTTTGATGCAGCGACATGTTTTGGTTGATGGTAAGGTCAGGACTGA-AAGACTTACCCTG
rJMFF025J24+ TTTTGATGCAGCGACATGTTTTGGTTGATGGTAAGGTCAGGACTGACAAGACTTACCCTG
rJMSF018N08+ TTTTGATGCAGCGACATGTTTTGGTTGATGGTAAGGTCAGGACTGACAAGACTTACCCTG
rJMSF035H20+ GCGACATGTTTTGGTTGATGGTAAGGTCAGGACTGACCAGACTTACCCTG
rJMSF031F04+ TTTTGATGCAGCGACATGTTTTGGTTGATGGTAAGGTCAGGACTGACAAGACTTACCCTG
rJMSF014G02+ TTTTGATGCAGCGACATGTTTTGGTTGATGGTAAGGTCAGGACTGACAAGACTTACCCTG
rJMSF018E18+ -TTTGATGCAGCGACATGTTTTGGTTGATGGTAAGGTCAGGACTGACAAGACTTACCCTG
                      ____________________________________________________________
consensus TTTTGATGCAGCGACATGTTTTGGTTGATGGTAAGGTCAGGACTGACAAGACTTACCCTG
 
. : . : . : . : . : . :
rJMFF008P05+ CTGGTTTCATGGATGTTGTTTCAATTCCAAAGACAAATGAGAACTTCCGCCTCTTCTATG
rJMFF025J24+ CTGGTTTCATGGATGTTGTTTCAATTCCAAAGACAAATGAGAACTTCCGCCTCTTCTATG
rJMSF018N08+ CTGGTTTCATGGATGTTGTTTCAATTCCAAAGACAAATGAGAACTTCCGCCCCTTCTATG
rJMSF035H20+ CTGGTTTCATGGATGTTGTTTCAATTCCAAAGACAAATGAGAACTTCCGCCTCTTCTATG
rJMSF031F04+ CTGGTTTCATGGATGTTGTTTCAATTCCAAAGACAAATGAGAACTTCCGCCTCTTCTATG
rJMSF044G19+ TTCTATG
rJMSF014G02+ CTGGTTTCATGGATGTTGTTTCAATTCCAAAGACAAATGAGAACTTCCGCCTCTTCTATG
rJMSF018E18+ CTGGTTTCATGGATGTTGTTTCAATTCCAAAGACAAATGAGAACTTCCGCCTCTTCTATG
                      ____________________________________________________________
consensus CTGGTTTCATGGATGTTGTTTCAATTCCAAAGACAAATGAGAACTTCCGCCTCTTCTATG
 
. : . : . : . : . : . :
rJMFF026E04+ TCAATCAGGGATGAGGAGGNTAAGTTTAAGCTTT
rJMFF001A20+ CAATCAGGGATGAGGAGGNTAAGTTTAAGCTTT
rJMFF008P05+ ATACCAAAGGGCGATTCCGACTTCACTCAATCAGGGATGAGGAGGCTAAGTTTAAGCTTT
rJMFF025J24+ ATACCAAAGGGCGATTCCGACTTCACTCAATCAGGGATGAGGAGGCTAAGTTTAAGCTTT
rJMSF018N08+ ATACCAAAGGGCGATTCCGACTTCACTCAATCAGGGATGAGGAGGCTAAGTTTAAGCTTT
rJMSF035H20+ ATACCAAAGGGCGATTCCGACTTCACTCAATCAGGGATGAGGAGGCTAAGTTTAAGCTTT
rJMSF031F04+ ATACCAAAGGGCGATTCCGACTTCACTCAATCAGGGATGAGGAGGCTAAGTTTAAGCTTT
rJMSF044G19+ ATACCAAAGGGCGATTCCGACTTCACTCAATCAGGGATGAGGAGGCTAAGTTTAAGCTTT
rJMSF014G02+ ATACCAAAGGGCGATTCCGACTTCACTCAATCAGGGATGAGGAGGCTAAGTTTAAGCTTT
rJMSF018E18+ ATACCAAAGGGCGATTCCGACTTCACTCAATCAGGGATGAGGAGGCTAAGTTTAAGCTTT
rJMFF039L13+ TCCGACTTCACTCAATCAGGGATGAGGAGGCTAAGTTTAAGCTTT
rJMFF024I14+ ACCAAAGGGCGATTCCGACTTCACTCAATCAGGGATGAGGAGGCTAAGTTTAAGCTTT
                      ____________________________________________________________
consensus ATACCAAAGGGCGATTCCGACTTCACTCAATCAGGGATGAGGAGGCTAAGTTTAAGCTTT
 
. : . : . : . : . : . :
rJMFF026E04+ GCAAAGTCCGCTNTNTTCAGTTTGGAAAGAAGGGAATTCCATTCATCANCACCTATGATG
rJMFF001A20+ GCAAAGTCCGCTCTNTTCAGTTTGGAAAGAAGGGAATTCCATTCATCANCACCTATGATG
rJMFF008P05+ GCAAAGTCCGCTCTGTTCAGTTTGGAAAGAAGGGAATTCCATTCATCAACACCTATGATG
rJMFF025J24+ GCAAAGTCCGCTCTGTTCAGTTTGGAAAGAAGGGAATTCCATTCATCAACACCTATGATG
rJMSF018N08+ GCAAAGTCCGCTCTGTTCAGTTTGGAAAGAAGGGAATTCCATTCATCAACACCTATGATG
rJMSF035H20+ GCAAAGTCCGCTCTGTTCAGTTTGGAAAGAAGGGAATTCCATTCATCAACACCTATGATG
rJMSF031F04+ GCAAAGTCCGCTCTGTTCAGTTTGGAAAGAAGGGAATTCCATTCATCAACACCTATGATG
rJMSF044G19+ GCAAAGTCCGCTCTGTTCAGTTTGGAAAGAAGGGAATTCCATTCATCAACACCTATGATG
rJMSF014G02+ GCAAAGTCCGCTCTGTTCAGTTTGGAAAGAAGGGAATTCCATTCATCAACACCTATGATG
rJMSF018E18+ GCAAAGTCCGCTCTGTTCAGTTTGGAAAGAAGGGAATTCCATTCATCAACACCTATGATG
rJMFF039L13+ GCAAAGTCCGCTCTGTTCAGTTTGGAAAGAAGGGAATTCCATTCATCAACACCTATGATG
rJMFF042P10+ TTGGAAAGAAGGGAATTCCATTCATCAACACCTATGATG
rJMFF024I14+ GCAAAGTCCGCTCTGTTCAGTTTGGCAAGAAGGGAATTCCATTCATCAGCACCTATGATG
                      ____________________________________________________________
consensus GCAAAGTCCGCTCTGTTCAGTTTGGAAAGAAGGGAATTCCATTCATCAACACCTATGATG
 
. : . : . : . : . : . :
rJMFF026E04+ GTAGAACCATCCGCTACCNTGATCCTCTNATCAAGGATAATGACACAGTAAAGCTGGACN
rJMFF001A20+ GTAGAACCATCCGCTACCCTGATCCTCTCATCAAGGNTAATGACNCAGTAAAGCTGGACC
rJMFF008P05+ GTAGAACCATCCGCTACCCTGATCCTCTCATCAAGGCTAATGACACAGTAAAGCTGGACC
rJMFF025J24+ GTAGAACCATCCGCTACCCTGATCCTCTCATCAAGGCTAATGACACAGTAAAGCTGGACC
rJMSF018N08+ GTAGAACCATCCGCTACCCTGATCCTCTCATCAAGGCTAATGACACAGTAAAGCTGGACC
rJMSF035H20+ GTAGAACCATCCGCTACCCTGATCCTCTCATCAAGGCTAATGACACAGTAAAGCTGGACC
rJMSF031F04+ GTAGAACCATCCGCTACCCTGATCCTCTCATCAAGGCTAATGACACAGTAAAGCTGGACC
rJMSF044G19+ GTAGAACCATCCGCTACCCTGATCCTCTCATCAAGGCTAATGACACAGTAAAGCTGGACC
rJMSF014G02+ GTAGAACCATCCGCTACCCTGATCCTCTCATCAAGGCTAATGACACAGTAAAGCTGGACC
rJMSF018E18+ GTAGAACCATCCGCTACCCTGATCCTCTCATCAAGGCTAATGACACAGTAAAGCTGGACC
rJMFF039L13+ GTAGAACCATCCGCTACCCTGATCCTCTCATCAAGGCTAATGACACAGTAAAGCTGGACC
rJMFF042P10+ GTAGAACCATCCGCTACCCTGATCCTCTCATCAAGGCTAATGACACAGTAAAGCTGGACC
rJMFF024I14+ GTAGAACCATCCGCTACCNTGATCCTCTCATCAAGGCTAATGACACAGTAAAGCTGGACC
                      ____________________________________________________________
consensus GTAGAACCATCCGCTACCCTGATCCTCTCATCAAGGCTAATGACACAGTAAAGCTGGACC
 
. : . : . : . : . : . :
rJMFF026E04+ TAGAGAGCAACAAGGTNGTTGACTTCATCAAGTNTGACGTGGGGAATGTTGTTATGGTCA
rJMFF001A20+ TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTNTGACGTGGGGAATGTTGTTATGGTCA
rJMFF026E15+ GAGAGCAACAAGGTNGTTGACTTCATCAAGTNNGACGTGGGGAATGNTGTTATGGTCN
rJMFF008P05+ TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTTTGACGTGGGGAATGTTGTTATGGTCA
rJMFF025J24+ TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTTTGACGTGGGGAATGTTGTTATGGTCA
rJMSF018N08+ TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTTTGACGTGGGGAATGTTGTTATGGTCA
rJMSF035H20+ TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTTTGACGTGGGGAATGTTGTTATGGTCA
rJMSF031F04+ TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTTTGACGTGGGGAATGTTGTTATGGTCA
rJMSF044G19+ TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTTTGACGTGGGGAATGTTGTTATGGTCA
rJMSF014G02+ TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTTTGACGTGGGGAATGTTGTTATGGTCA
rJMSF018E18+ TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTTTGACGTGGGGAATGTTGTTATGGTCA
rJMFF039L13+ TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTTTGACGTGGGGAATGTTGTTATGGTCA
rJMFF042P10+ TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTTTGACGTGGGGAATGTTGTTATGGTCA
JMFS030D03- GGGAATGTTGTTATGGTCA
rJMFF024I14+ TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTTTGACGTGGGGAATGTTGTTATGGTCA
                      ____________________________________________________________
consensus TAGAGAGCAACAAGGTTGTTGACTTCATCAAGTTTGACGTGGGGAATGTTGTTATGGTCA
 
. : . : . : . : . : . :
rJMFF026E04+ NTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
rJMFF001A20+ TTGGTGGAAGAANCAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
rJMFF026E15+ TNGGTGGAAGAAACAGNGGANGTGTTGGCGTCATCAAGAATAGGGAGAAGCATNAGGGAA
rJMFF008P05+ CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
rJMFF025J24+ CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
rJMSF018N08+ CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
rJMSF035H20+ CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
rJMSF031F04+ CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
rJMSF044G19+ CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
rJMSF014G02+ CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
rJMSF018E18+ CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
rJMFF039L13+ CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
rJMFF042P10+ CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
JMFS030D03- CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
rJMFF024I14+ CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
                      ____________________________________________________________
consensus CTGGTGGAAGAAACAGGGGACGTGTTGGCGTCATCAAGAATAGGGAGAAGCATAAGGGAA
 
. : . : . : . : . : . :
rJMFF026E04+ GCTTCGAGNCTGTCCNCATCCAGGATGCCACTGGGCATGAGTNTGNTACTCGTTTGGGGA
rJMFF001A20+ GCTTCGAGNCTGTCCACATCCAGGATGCCACTGGGCATGAGTNTGNTACTCGTTTGGGGA
rJMFF026E15+ GNTTCGAGNCTGTCCNCATCCAGGATGNCNCNGGGCANGAGNNTGNTACTNGTTNGGGGA
rJMFF008P05+ GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
rJMFF025J24+ GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
rJMSF018N08+ GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
rJMSF035H20+ GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
rJMSF031F04+ GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
rJMSF044G19+ GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
rJMSF014G02+ GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
rJMSF018E18+ GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
rJMFF039L13+ GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
rJMFF042P10+ GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
rJMFF047C07+ TGGGCATGAGTTTGCTACTCGTTTGGGGA
JMFS030D03- GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
rJMFF024I14+ GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
                      ____________________________________________________________
consensus GCTTCGAGACTGTCCACATCCAGGATGCCACTGGGCATGAGTTTGCTACTCGTTTGGGGA
 
. : . : . : . : . : . :
rJMFF026E04+ ATGNGTTCANTATTGGAAAAGGCANTAAGCCTNGGGTTTCTNTNCCCAAGGGTAAGGGTA
rJMFF001A20+ ATGNGTTCANTATTGGAAAAGGCNNTAAGCNTNGGGTTTNTNTNCCCAAGGGTAAGGGTA
rJMFF026E15+ ANGNGTTCNNTATTGGAAAAGGCNGTAANCCTNGGGTTTCTTTNCCCAAGGGTAAGGGTA
rJMFF008P05+ ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
rJMFF025J24+ ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
rJMSF018N08+ ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
rJMSF035H20+ ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
rJMSF031F04+ ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
rJMSF044G19+ ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
rJMSF014G02+ ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
rJMSF018E18+ ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
rJMFF039L13+ ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
rJMFF042P10+ ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
rJMFF047C07+ ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
JMFS030D03- ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
rJMFF024I14+ ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
                      ____________________________________________________________
consensus ATGTGTTCACTATTGGAAAAGGCACTAAGCCTTGGGTTTCTCTGCCCAAGGGTAAGGGTA
 
. : . : . : . : . : . :
rJMFF026E04+ TCAAGCTGTCCATCATNGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTNTGCAACCACTG
rJMFF001A20+ TCAAGCTGTCCATCATNGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTNTNCAACCACTG
rJMFF026E15+ TCAAGCNGTCCATCATCGAAGAGGCAAAGAAGAGGCNTGNTGCCCAGT
rJMFF008P05+ TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
rJMFF025J24+ TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
rJMSF018N08+ TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
rJMSF035H20+ TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
rJMSF031F04+ TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
rJMSF044G19+ TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
rJMSF014G02+ TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
rJMSF018E18+ TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
rJMFF039L13+ TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
rJMFF042P10+ TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
rJMFF047C07+ TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
JMFS030D03- TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
rJMFF024I14+ TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
                      ____________________________________________________________
consensus TCAAGCTGTCCATCATTGAAGAGGCAAAGAAGAGGCTTGCTGCCCAGTCTGCAACCACTG
 
. : . : . : . : . : . :
rJMFF026E04+ CNTAAATGCACNGTAGGCTTTCCTCCAATACCCCATATNTNCTTTGAAGTAATTTACAAG
rJMFF001A20+ CNTAAATGCACNGTAGGCTTTCCTCCAATACCCCATATNTNCTTTGAAGTAATNTACAAG
rJMFF008P05+ CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
rJMFF025J24+ CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
rJMSF018N08+ CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
rJMSF035H20+ CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
rJMSF031F04+ CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
rJMSF044G19+ CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
rJMSF014G02+ CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
rJMSF018E18+ CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
rJMFF039L13+ CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
rJMFF042P10+ CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
rJMFF047C07+ CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
JMFS030D03- CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
rJMFF024I14+ CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
                      ____________________________________________________________
consensus CCTAAATGCACTGTAGGCTTTCCTCCAATACCCCATATCTGCTTTGAAGTAATTTACAAG
 
. : . : . : . : . : . :
rJMFF026E04+ TNTGATAGAATTTTGTT
rJMFF001A20+ TNTGATAGAATNTTGTT
rJMFF008P05+ TTTGATAGAATTTTGTTCTGCAGGTTGAACTAATGTAGATTTCTTATTTAAATGTGTAAT
rJMFF025J24+ TTTGATAGAATTTTGTTCTGCAGTTTGAACTAATGTAGATTTCTTATTTAAATGTGTAAT
rJMSF018N08+ TTTGATAGAATTTTGTTCTGCAGGTTGAACTAATGTAGATTTCTTATTTAAATGTGTAAT
rJMSF035H20+ TTTGATAGAATTTTGTTCTGCAGGTTGAACTAATGTAGATTTCTTATTTAAATGTGTAAT
rJMSF031F04+ TTTGATAGAATTTTGTTCTGCAGGTTGAACTAATGTAGATT
rJMSF044G19+ TTTGATAGAATTTTGTTCTGCAGGTTGAACTAATGTAGATTTCTTATTTAAATGTGTAAT
rJMSF014G02+ TTTGATAGAATTTTGTTCTGCAGGTTGAACTAATGTAGATTTCTTATTTAAATGTGTAAT
rJMSF018E18+ TTTGATAGAATTTTGTTCTGCAGGTTGAACTAATGTAGATTTCTTATTTAAATGTGTAAT
rJMFF039L13+ TTTGATAGAATTTTGTTCTGCAGGTTGAACTAATGTAGATTTCTTATTTAAATGTGTAAT
rJMFF042P10+ TTTGATAGAATTTTGTTCTGCAGGTTGAACTAATGTAGATTTCTTATTTAAATGTGTAAT
rJMFF047C07+ TTTGATAGAATTTTGTTCTGCAGGTTGAACTAAT
JMFS030D03- TTTGATAGAATTTTGTTCTGCAGGTTGAACTAATGTAGATTTCTTATTTAAATGTGTAAT
rJMFF024I14+ TTTGATAGAATTTTGTTCTGCAGGTTGAACTAATGTAGATTTCTTATTTAAATGTGTAAT
                      ____________________________________________________________
consensus TTTGATAGAATTTTGTTCTGCAGGTTGAACTAATGTAGATTTCTTATTTAAATGTGTAAT
 
. : . : . : . : . : . :
rJMFF008P05+ GCA
rJMFF025J24+ GCATGCTCTTCGATTT
rJMSF018N08+ GCATGCTCTTCGATTTTCAGAATTACTGT
rJMSF035H20+ GCATGCTCTTCGATTTTCAGAATTACTGT
rJMSF044G19+ GCATGCTCTTCGATTTTCAGAATTACTGTTACTC
rJMSF014G02+ GCATGCTCTTCGATTTTCAGAATTACTGTTACTCAGT
rJMSF018E18+ GCATGCTCTTCGATTTTCAGAATTACTGTTACTCAGTTGCATACTTTT
rJMFF039L13+ GCATGCTCTTCGATTTTCAGAATTACTGTTACTCAGTTGCATACTTTTTTTCCTGAGATG
rJMFF042P10+ GCATGCTCTTCGATTTTCAGAATTACTGTTACTCAGTTGCATACTTTTTTTCCTGAGATG
JMFS030D03- GCATGCTCTTCGATTTTCAGAATTACTGTTACTCAGTTGCATACTTTTTTTCCTGAGATG
rJMFF024I14+ GCATGCTCTTCGATTTTCAGAATTACTGTTACTCAGTTGCATACTTTTTTTCCTGAGATG
                      ____________________________________________________________
consensus GCATGCTCTTCGATTTTCAGAATTACTGTTACTCAGTTGCATACTTTTTTTCCTGAGATG
 
. : . : . : . : . : . :
rJMFF039L13+ GAAATTGAC
rJMFF042P10+ GAAATTGACTGTTGAAG
JMFS030D03- GAAATTGACTGTTGAAG
rJMFF024I14+ GAAATTGACTGTTGAAGAACTCTTCTCCTTTATCTTAATTCTTTATTTTGGGTTTGCATC
                      ____________________________________________________________
consensus GAAATTGACTGTTGAAGAACTCTTCTCCTTTATCTTAATTCTTTATTTTGGGTTTGCATC
 
. : . : . : . : . : . :
rJMFF024I14+ TATTTCTTTAAGGTAACCAATGCAATCATTTGCTATATGCAGGCCTTTAATAAAATTTTG
                      ____________________________________________________________
consensus TATTTCTTTAAGGTAACCAATGCAATCATTTGCTATATGCAGGCCTTTAATAAAATTTTG