Previous Contig 009351:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024H17Sequence479005869 (5)pir|T10558|T105586e-16hypothetical protein T12G13.150 - Arabidopsis thaliana>gb:ATCHRIV23_1544547 Arab768009351 (5)pir|T10558|T105583e-19hypothetical protein T12G13.150 - Arabidopsis thaliana>gb:ATCHRIV23_1544547 Arab
JMSF001M01Sequence410005869 (5)pir|T10558|T105584e-16hypothetical protein T12G13.150 - Arabidopsis thaliana>gb:ATCHRIV23_1544547 Arab681009351 (5)pir|T10558|T105582e-10hypothetical protein T12G13.150 - Arabidopsis thaliana>gb:ATCHRIV23_1544547 Arab
JMSF002M03Sequence341005869 (5)pir|T10558|T105583e-11hypothetical protein T12G13.150 - Arabidopsis thaliana>gb:ATCHRIV23_1544547 Arab758009351 (5)pir|T10558|T105583e-10hypothetical protein T12G13.150 - Arabidopsis thaliana>gb:ATCHRIV23_1544547 Arab
JMSF020B18Sequence656005869 (5)pir|T10558|T105582e-17hypothetical protein T12G13.150 - Arabidopsis thaliana>gb:ATCHRIV23_1544547 Arab383009351 (5)
JMSF052I03Sequence263005869 (5)pir|T10558|T105582e-04hypothetical protein T12G13.150 - Arabidopsis thaliana>gb:ATCHRIV23_1544547 Arab846009351 (5)pir|T10558|T105582e-07hypothetical protein T12G13.150 - Arabidopsis thaliana>gb:ATCHRIV23_1544547 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052I03+ AAGGAGA
                      ____________________________________________________________
consensus AAGGAGA
 
. : . : . : . : . : . :
rJMSF052I03+ NTCNCTAAAGATCCTTACCCTAATTATTTGCTATCTCTAAAGGAAATAAATCAATTNTAA
                      ____________________________________________________________
consensus NTCNCTAAAGATCCTTACCCTAATTATTTGCTATCTCTAAAGGAAATAAATCAATTNTAA
 
. : . : . : . : . : . :
rJMSF052I03+ TNGTAAAGATAATAAATCAGTTATAATAATAAAGATNTTCCCTTAATCATCATATCAGAT
                      ____________________________________________________________
consensus TNGTAAAGATAATAAATCAGTTATAATAATAAAGATNTTCCCTTAATCATCATATCAGAT
 
. : . : . : . : . : . :
rJMSF002M03+ AGCATTCCTCCTTC
rJMSF052I03+ TTTCCCATGTTTACNCCCAATATTCTTACCACTTGTACCTCTCCACAGCATTCCTCCTTC
rJMSF001M01+ AGCATTCCTCCTTC
rJMFF024H17+ AGCATTCCTCCTTC
                      ____________________________________________________________
consensus TTTCCCATGTTTACNCCCAATATTCTTACCACTTGTACCTCTCCACAGCATTCCTCCTTC
 
. : . : . : . : . : . :
rJMSF002M03+ CATTTACAAGAAAGCTAAGCAGGTTCCAGAAGATGAACGTGAGGAATTCTTAAGTAAGGA
rJMSF052I03+ CATTTACAAGAAAGCTAAGCAGGTTCCAGAAGATGNACGTGAGGAATTCTNAAGTANGGA
rJMSF001M01+ CATTTACAAGAAAGCTAAGCAGGTTCCAGAAGATGAACGTGAGGAATTCTTAAGTAAGGA
rJMFF024H17+ CATTTACAAGAAAGCTAAGCAGGTTCCAGAAGATGAACGTGAGGAATTCTTAAGTAAGGA
                      ____________________________________________________________
consensus CATTTACAAGAAAGCTAAGCAGGTTCCAGAAGATGAACGTGAGGAATTCTTAAGTAAGGA
 
. : . : . : . : . : . :
rJMSF002M03+ GTTAGAAGACATACTCTCAAGAGAAGGGCTGTCAAGTAATCCTTCTGAGAAAGAAATTAA
rJMSF052I03+ GTTAGAAGACATACTCTCAAGNGAAGGGCTGTCAAGTAATCCTTCTGAGAAAGAAATTAA
rJMSF001M01+ GTTAGAAGACATACTCTCAAGAGAAGGGCTGTCAAGTAATCCTTCTGAGAAAGAAATTAA
rJMFF024H17+ GTTAGAAGACATACTCTCAAGAGAAGGGCTGTCAAGTAATCCTTCTGAGAAAGAAATTAA
                      ____________________________________________________________
consensus GTTAGAAGACATACTCTCAAGAGAAGGGCTGTCAAGTAATCCTTCTGAGAAAGAAATTAA
 
. : . : . : . : . : . :
rJMSF002M03+ AGAAGTAAAAAAGAAAAAAGAAAGAGCTAAAGAACTAGAAGGAATTGACCTCAGCAACAT
rJMSF052I03+ AGAAGTAAAAAAGNAAAAAGAAAGAGCTAAAGAACTAGAANGAATTGACCTCAGCAACAT
rJMSF001M01+ AGAAGTAAAAAAGAAAAAAGAAAGAGCTAAAGAACTAGAAGGAATTGACCTCAGCAACAT
rJMSF020B18+ TAAAAAAGAAAANNGAAAGAGCTAANGAACTAGAAGGAATTGNCCTCNGCAACAT
rJMFF024H17+ AGAAGTAAAAAAGAAAAAAGAAAGAGCTAAAGAACTAGAAGGAATTGACCTCAGCAACAT
                      ____________________________________________________________
consensus AGAAGTAAAAAAGAAAAAAGAAAGAGCTAAAGAACTAGAAGGAATTGACCTCAGCAACAT
 
. : . : . : . : . : . :
rJMSF002M03+ TGTTTCAAGTACACGAAGAAGGTCAACGACCAGCTTTGTGCCTCCTCCAAAACCCAAGTC
rJMSF052I03+ TGTTTCAAGTNCACGANGAAGGTCAACGACCAGCTTTGTGCCTCCTCCAAAACCCAAGTC
rJMSF001M01+ TGTTTCAAGTACACGAAGAAGGTCAACGACCAGCTTTGTGCCTCCTCCAAAACCCAAGTC
rJMSF020B18+ TGNNTCAAGTACACGAAGAAGGTCAACGACCAGCTTTGTGCCTCCTCCAAAACCCANGTC
rJMFF024H17+ TGTTTCAAGTACACGAAGAAGGTCAACGACCAGCTTTGTGCCTCCTCCAAAACCCAAGTC
                      ____________________________________________________________
consensus TGTTTCAAGTACACGAAGAAGGTCAACGACCAGCTTTGTGCCTCCTCCAAAACCCAAGTC
 
. : . : . : . : . : . :
rJMSF002M03+ ACCTGTTAAAGATGACAAGAGTGATGCTGAAGATAGTGACAAAGAGGATTCAAGTGATGA
rJMSF052I03+ NCCTGTTAAAGATGACAAGAGNGATGCTGAAGATAGTGACAAAGAGGATTCAAGTGATGA
rJMSF001M01+ ACCTGTTAAAGATGACAAGAGTGATGCTGAAGATAGTGACAAAGAGGATTCAAGTGATGA
rJMSF020B18+ ACCTGTTNAAGATGACAAGAGTGATGCTGNNGATAGTGACAAAGNGGATTCANGNGATGC
rJMFF024H17+ ACCTGTTAAAGATGACAAGAGTGATGCTGAAGATAGTGACAAAGAGGATTCAAGTGATGA
                      ____________________________________________________________
consensus ACCTGTTAAAGATGACAAGAGTGATGCTGAAGATAGTGACAAAGAGGATTCAAGTGATGA
 
. : . : . : . : . : . :
rJMSF002M03+ CAGTGATACTGAGGAAGATGGTGATGGTTCTCAGATTGATGAGATAAATGAAGATCATGA
rJMSF052I03+ CAGTGATACTGAGGAAGATGGTGATGGTTCTCAGATTGATGAGATAAATGAAGATCATGA
rJMSF001M01+ CAGTGATACTGAGGAAGATGGTGATGGTTCTCAGATTGATGAGATAAATGAAGATCATGA
rJMSF020B18+ CAGTGNTANTGNGGAAGATGGTGANNGTTCTCAGNGTGATGAGATAAATGAAGATCNTGA
rJMFF024H17+ CAGTGATACTGAGGAAGATGGTGATGGTTCTCAGATTGATGAGATAAATGAAGATCATGA
                      ____________________________________________________________
consensus CAGTGATACTGAGGAAGATGGTGATGGTTCTCAGATTGATGAGATAAATGAAGATCATGA
 
. : . : . : . : . : . :
rJMSF002M03+ AGAAGACAGTGACTGAATCTTATGTAGCCATCTCAGAAGAACTCTGACGCACAAAGACCA
rJMSF052I03+ AGAAGACAGTGACTGAATCTTATGTAGCCATCTCAGAAGAACTCTGACGCACAAAGACCA
rJMSF001M01+ AGAAGACAGTGACTGAATCTTATGTAGCCATCTCAGAAGAACTCTGACGCACAAAGACCA
rJMSF020B18+ AGAAGGCAGTGCCTGANTCTTATGTAGCCATCTCAGANGNNCTCNGNCGCACAAAGACCA
rJMFF024H17+ AGAAGACAGTGACTGAATCTTATGTAGCCATCTCAGAAGAACTCTGACGCACAAAGACCA
                      ____________________________________________________________
consensus AGAAGACAGTGACTGAATCTTATGTAGCCATCTCAGAAGAACTCTGACGCACAAAGACCA
 
. : . : . : . : . : . :
rJMSF002M03+ TGCACAAAGACAATTGCTGTTCAAATTGATTTGGGAGCTGGAATTTGTAATATATGTCAA
rJMSF052I03+ TGCACAAAGACAATTGCTGTTCAAATTGATTTGGGAGCTGGAATTTGTAATATATGTCAA
rJMSF001M01+ TGCACAAAGACAATTGCTGTTCAAATTGATTTGGGAGCTGGAATTTGTAATATATGTCAA
rJMSF020B18+ TGCNCAAAGACAAATCCTGTTCAAATTGATTTGGGAGCGGGAATAAGTAATATATGTCAA
rJMFF024H17+ TGCACAAAGACAATTGCTGTTCAAATTGATTTGGGAGCTGGAATTTGTAATATATGTCAA
                      ____________________________________________________________
consensus TGCACAAAGACAATTGCTGTTCAAATTGATTTGGGAGCTGGAATTTGTAATATATGTCAA
 
. : . : . : . : . : . :
rJMSF002M03+ AGAGGGCTTTCCATCACAGTTTTGAGACTTAGCTGCTTTTCGAAGGTGTAGTCTACTAGT
rJMSF052I03+ AGAGGGCTTTCCATCACNGTTTTGAGACTTAGCTGCTNTTCGAAGGTGTAGTCTACTAGT
rJMSF001M01+ AGAGGGCTTTCCATCACAGTTTTGAGACTTAGCTGCTTTTCGAAGGTGTAGTCTACTAGT
rJMSF020B18+ AGAGGGCTTTCCNNCACAGTTTTG
rJMFF024H17+ AGAGGGCTTTCCATCACAGTTTTGAGACTTAGCTGCTTTTCGAAGGTGTAGTCTACTAGT
                      ____________________________________________________________
consensus AGAGGGCTTTCCATCACAGTTTTGAGACTTAGCTGCTTTTCGAAGGTGTAGTCTACTAGT
 
. : . : . : . : . : . :
rJMSF002M03+ ACTTTGGACTAAAATCATTCTATTCTCTGCTGTAGGAGGCGGCAAAGTTGCTGCTGCTTG
rJMSF052I03+ ACTTTGGACTAAAATCATTCTATTCTCTGCTGTAGGAGGCGGCAAAGTTGCTGCTGCTTG
rJMSF001M01+ ACTTTGGACTAAAATCATTCTATTCTCTGCTGTAGGAGGCGGCAAAGTTGCTGCTGCTTG
rJMFF024H17+ ACTTTGGACTAAAATCATTCTATTCTCTGCTGTAGGAGGCGGCAAAGTTGCTGCTGCTTG
                      ____________________________________________________________
consensus ACTTTGGACTAAAATCATTCTATTCTCTGCTGTAGGAGGCGGCAAAGTTGCTGCTGCTTG
 
. : . : . : . : . : . :
rJMSF002M03+ TAGA-CTGTGATGGGAAGTAACTTACAAAC
rJMSF052I03+ TAGATCTGTGATGGGAAGTNACTTACAAACAGTTTTCGGATA-TTGTANCTGTCTAGGAT
rJMSF001M01+ TAGA-CTGTGATGGGAAGTAACTTACAAAC
rJMFF024H17+ TAGA-CTGTGATGGGAAGTAACTTACAAACAGTTTTTGGATATTTGTAACTGTCTAGGAT
                      ____________________________________________________________
consensus TAGA-CTGTGATGGGAAGTAACTTACAAACAGTTTTTGGATATTTGTAACTGTCTAGGAT