Previous Contig 009349:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024G18Sequence464009349 (6)gb:AC132489_17411802e-38Oryza sativa (japonica cultivar-group) chromosome 5 clone P0537C11, complete seq808009349 (6)gb:AC132489_17411804e-56Oryza sativa (japonica cultivar-group) chromosome 5 clone P0537C11, complete seq
JMSF021D16Sequence675009349 (6)gb:AC132489_17411802e-76Oryza sativa (japonica cultivar-group) chromosome 5 clone P0537C11, complete seq797009349 (6)gb:AC132489_17411807e-54Oryza sativa (japonica cultivar-group) chromosome 5 clone P0537C11, complete seq
JMSF049F15Sequence703009349 (6)gb:AC132489_17411806e-74Oryza sativa (japonica cultivar-group) chromosome 5 clone P0537C11, complete seq793009349 (6)gb:AY086393_15714421e-50Arabidopsis thaliana clone 2489 mRNA, complete sequence.>gb:BT003998_1637115 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021D16- CGGAGTGCGCTGCTTGGATT
JMFF024G18- CGGAGTGCGCTGCTTGGATT
JMSF049F15- GAGAAGAAACACAGTTGCGGAGTGCGCTGCTTGGATT
                      ____________________________________________________________
consensus GAGAAGAAACACAGTTGCGGAGTGCGCTGCTTGGATT
 
. : . : . : . : . : . :
JMSF021D16- GGGAGATTTGGTGAGAGTTCCCACGCTTGAAAGTTGAAATCCAGATCTTCGTTCTCGTTT
JMFF024G18- GGGAGATTTGGTGAGAGTTCCCACGCTTGAAAGTTGAAATCCAGATCTTCGTTCTCGTTT
JMSF049F15- GGGAGATTTGGTGAGAGTTCCCACGCTTGAAAGTTGAAATCCAGATCTTCGTTCTCGTTT
                      ____________________________________________________________
consensus GGGAGATTTGGTGAGAGTTCCCACGCTTGAAAGTTGAAATCCAGATCTTCGTTCTCGTTT
 
. : . : . : . : . : . :
JMSF021D16- AGATTCCGCCGTGAATTTGAATTGTAATTCGGAGATAGAGCTAGAAATGGATCCGGACTC
JMFF024G18- AGATTCCGCCGTGAATTTGAATTGTAATTCGGAGATAGAGCTAGAAATGGATCCGGACTC
JMSF049F15- AGATTCCGCCGTGAATTTGAATTGTAATTCGGAGATAGAGCTAGAAATGGATCCGGACTC
                      ____________________________________________________________
consensus AGATTCCGCCGTGAATTTGAATTGTAATTCGGAGATAGAGCTAGAAATGGATCCGGACTC
 
. : . : . : . : . : . :
JMSF021D16- GGTGAAATCAACTCTTTCTACGTTGGCATTTGGAAATGTCATGGCCGCGGCAGCTCGCGA
JMFF024G18- GGTGAAATCAACTCTTTCTACGTTGGCATTTGGAAATGTCATGGCCGCGGCAGCTCGCGA
JMSF049F15- GGTGAAATCAACTCTTTCTACGTTGGCATTTGGAAATGTCATGGCCGCGGCAGCTCGCGA
                      ____________________________________________________________
consensus GGTGAAATCAACTCTTTCTACGTTGGCATTTGGAAATGTCATGGCCGCGGCAGCTCGCGA
 
. : . : . : . : . : . :
JMSF021D16- TTATCAAAAGGAAGTGCTATCCAAGGACAAGGCACAGACTTCAAGTTCTGTTAATGTAGA
JMFF024G18- TTATCAAAAGGAAGTGCTATCCAAGGACAAGGCACAGACTTCAAGTTCTGTTAATGTAGA
JMSF049F15- TTATCAAAAGGAAGTGCTATCCAAGGACAAGGCACAGACTTCAAGTTCTGTTAATGTAGA
                      ____________________________________________________________
consensus TTATCAAAAGGAAGTGCTATCCAAGGACAAGGCACAGACTTCAAGTTCTGTTAATGTAGA
 
. : . : . : . : . : . :
JMSF021D16- TTTTGATCTTGATGAGCTAATGGATGATCCTGAATTGGAAAAGTTGCATGCTGATAGGAT
JMFF024G18- TTTTGATCTTGATGAGCTAATGGATGATCCTGAATTGGAAAAGTTGCATGCTGATAGGAT
JMSF049F15- TTTTGATCTTGATGAGCTAATGGATGATCCTGAATTGGAAAAGTTGCATGCTGATAGGAT
                      ____________________________________________________________
consensus TTTTGATCTTGATGAGCTAATGGATGATCCTGAATTGGAAAAGTTGCATGCTGATAGGAT
 
. : . : . : . : . : . :
JMSF021D16- TGCTGCTCTCAAGAAAGAAACTGAGAAGCGACAAGAATTGAAAAAGCATGGGCATGGAGA
JMFF024G18- TGCTGCTCTCAAGAAAGAAACTGAGAAGCGACAAGAATTGAAAAAGCATGGGCATGGAGA
JMSF049F15- TGCTGCTCTCAAGAAAGAAACTGAGAAGCGACAAGAATTGAAAAAGCATGGGCATGGAGA
rJMSF021D16+ TGAAAAAGCATNGGCNTGGAGA
rJMSF049F15+ AAAGCATGGGCNTGGAGA
rJMFF024G18+ ACAAGAATTGAAAAAGCATGGGCATGGAGA
                      ____________________________________________________________
consensus TGCTGCTCTCAAGAAAGAAACTGAGAAGCGACAAGAATTGAAAAAGCATGGGCATGGAGA
 
. : . : . : . : . : . :
JMSF021D16- GTATAGAGAGATTACTGAAGGGGACTTTTTGGGTGAAGTTACTGGCAGTGAAAAAGTGAT
JMFF024G18- GTATAGAGAGATTACTGAAGGGGACTTTTTGGGTGAAGTTACTGGCAGTGAAAAAGTGAT
JMSF049F15- GTATAGTGAGATTACTGAAGGGGACTTTTTGGGTGAAGTTACTGGCAGTGAAAAAGTGAT
rJMSF021D16+ GTATAGAGAGATTACTGAAGGGGACTTTTTGGGTGAAGTTACTGGCAGTGAAAAAGTGAT
rJMSF049F15+ GTATAGTGAGATTACTGAAGGGGACTTTTTGGGTGAAGTTACTGGCAGTGAAAAAGTGAT
rJMFF024G18+ GTATAGAGAGATTACTGAAGGGGACTTTTTGGGTGAAGTTACTGGCAGTGAAAAAGTGAT
                      ____________________________________________________________
consensus GTATAGAGAGATTACTGAAGGGGACTTTTTGGGTGAAGTTACTGGCAGTGAAAAAGTGAT
 
. : . : . : . : . : . :
JMSF021D16- TTGTCACTTTTACCATAGAGAGTTTTACCGATGCAAGATCATGGATAAGCATTTAAAGTC
JMFF024G18- TTGTCACTTTTACCATAGA
JMSF049F15- TTGTCACTTTTACCATAGAGAGTTTTACCGATGCAAGATCATGGATAAGCATTTAAAGTC
rJMSF021D16+ TTGTCACTTTTACCATAGAGAGTTTTACCGATGCAAGATCATGGATAAGCATTTAAAGTC
rJMSF049F15+ TTGTCACTTTTACCATAGAGAGTTTTACCGATGCAAGATCATGGATAAGCATTTAAAGTC
rJMFF024G18+ TTGTCACTTTTACCATAGAGAGTTTTACCGATGCAAGATCATGGATAAGCATTTAAAGTC
                      ____________________________________________________________
consensus TTGTCACTTTTACCATAGAGAGTTTTACCGATGCAAGATCATGGATAAGCATTTAAAGTC
 
. : . : . : . : . : . :
JMSF021D16- ACTTGCGCCAAGGCATTTTGATACTAAGTTCGTAAAATTGGATGCAGAGAATGCTCCC-T
JMSF049F15- ACTTGCGCCAAGGCATTTTGATACTAAGTTCGTAAAATTGGATGCAGAGAATGCTCCCTT
rJMSF021D16+ ACTTGCGCCAAGGCATTTTGATACTAAGTTCGTAAAATTGGATGCAGAGAATGCTCCC-T
rJMSF049F15+ ACTTGCGCCAAGGCATTTTGATACTAAGTTCGTAAAATTGGATGCAGAGAATGCTCCCTT
rJMFF024G18+ ACTTGCGCCAAGGCATTTTGATACTAAGTTCGTAAAATTGGATGCAGAGAATGCTCCC-T
                      ____________________________________________________________
consensus ACTTGCGCCAAGGCATTTTGATACTAAGTTCGTAAAATTGGATGCAGAGAATGCTCCC-T
 
. : . : . : . : . : . :
JMSF021D16- TTTTTGTTACCAAGCTAGGAATCAAAACTTTGCCATGTGTCATCTTGTTCAGGAAAGGAA
JMSF049F15- TTTTTGTTACCAAGCTAGGAATCAAAACTTTGCCATGTGTCATCTTGTTCAGGAAAGGAA
rJMSF021D16+ TTTTTGTTACCAAGCTAGGAATCAAAACTTTGCCATGTGTCATCTTGTTCAGGAAAGGAA
rJMSF049F15+ TTTTTGTTACCAAGCTAGGAATCAAAACTTTGCCATGTGTCATCTTGTTCAGGAAAGGAA
rJMFF024G18+ TTTTTGTTACCAAGCTAGGAATCAAAACTTTGCCATGTGTCATCTTGTTCAGGAAAGGAA
                      ____________________________________________________________
consensus TTTTTGTTACCAAGCTAGGAATCAAAACTTTGCCATGTGTCATCTTGTTCAGGAAAGGAA
 
. : . : . : . : . : . :
JMSF021D16- TTGCTACAGATAGGCTGGTTGGATTCCAGGACCTGGGAGGAAAGGATGATTTCT
JMSF049F15- TTGCTACAGATAGGCTGGTTGGATTCCAGGACCTGGGAGGAAAGGATGATTTCTCCACAA
rJMSF021D16+ TTGCTACAGATAGGCTGGTTGGATTCCAGGACCTGGGAGGAAAGGATGATTTCTCCACAA
rJMSF049F15+ TTGCTACAGATAGGCTGGTTGGATTCCAGGACCTGGGAGGAAAGGATGATTTCTCCACAA
rJMFF024G18+ TTGCTACAGATAGGCTGGTTGGATTCCAGGACCTGGGAGGAAAGGATGATTTCTCCACAA
                      ____________________________________________________________
consensus TTGCTACAGATAGGCTGGTTGGATTCCAGGACCTGGGAGGAAAGGATGATTTCTCCACAA
 
. : . : . : . : . : . :
JMSF049F15- AAACAC
rJMSF021D16+ AAACACTGGAAACTTATCTGTTAAAGAAAGGAATAATCAAGGAGAACAAACCAGATGATG
rJMSF049F15+ AAACACTGGAAACTTATCTGTTAAAGAAAGGAATAATCAAGGAGAACAAACCAGATGATG
rJMFF024G18+ AAACACTGGAAACTTATCTGTTAAAGAAAGGAATAATCAAGGAGAACAAACCAGATGATG
                      ____________________________________________________________
consensus AAACACTGGAAACTTATCTGTTAAAGAAAGGAATAATCAAGGAGAACAAACCAGATGATG
 
. : . : . : . : . : . :
rJMSF021D16+ ATGACGATGAGAGAGATTATGATAATGGACGCAGGGCGGTGAGGTCATCTGTGCATTCTG
rJMSF049F15+ ATGACGATGAGAGAGATTATGATAATGGACGCAGGGCGGTGAGGTCATCTGCGCATTCTG
rJMFF024G18+ ATGACGATGAGAGAGATTATGATAATGGACGCAGGGCGGTGAGGTCATCTGCGCATTCTG
                      ____________________________________________________________
consensus ATGACGATGAGAGAGATTATGATAATGGACGCAGGGCGGTGAGGTCATCTGCGCATTCTG
 
. : . : . : . : . : . :
rJMSF021D16+ ATTCAGATTCCGATTGATAAAGGAATTTGAAGAAAGCCGGTCTTTATCCCAGCTGCAAAC
rJMSF049F15+ ATTCAGATTCCGATTGATAAAGGAATTTGAAGAAAGCCGGTCTTTATCCCAGCTGCAAAC
rJMFF024G18+ ATTCAGATTCCGATTGATAAAGGAATTTGAAGAAAGCCGGTCTTTATCCCAGCTGCAAAC
                      ____________________________________________________________
consensus ATTCAGATTCCGATTGATAAAGGAATTTGAAGAAAGCCGGTCTTTATCCCAGCTGCAAAC
 
. : . : . : . : . : . :
rJMSF021D16+ TGCCGAGACTGTCATGCTTGGCATTTCAGACGATTAGGAGAGTGCAGTGTCTTGGATGAC
rJMSF049F15+ TGCCGAGACTGTCATGCTTGGCATTTCAGACGATTAGGAGAGTGCAGTGTCTTGGATGAC
rJMFF024G18+ TGCCGAGACTGTCATGCTTGGCATTTCAGACGATTAGGAGAGTGCAGTGTCTTGGATGAC
                      ____________________________________________________________
consensus TGCCGAGACTGTCATGCTTGGCATTTCAGACGATTAGGAGAGTGCAGTGTCTTGGATGAC
 
. : . : . : . : . : . :
rJMSF021D16+ CTTTTACCGTTTTACGTTTTGTGTACTATTCTTCAAGTACAAGAGGGAGAGAATTTGGTG
rJMSF049F15+ CTTTTACCGTTTTACGTTTTGTGTACTATTCTTCAAGTACAAGAGGGAGAGAATTTGGTG
rJMFF024G18+ CTTTTACCGTTTTACGTTTTGTGTACTATTCTTCAAGTACAAGAGGGAGAGAATTTGGTG
                      ____________________________________________________________
consensus CTTTTACCGTTTTACGTTTTGTGTACTATTCTTCAAGTACAAGAGGGAGAGAATTTGGTG
 
. : . : . : . : . : . :
rJMSF021D16+ GAAGTAATCATTTTAGCAGAGCTTCATCTCTATTGACCAAAAACAAAAAAAGCATTGTAT
rJMSF049F15+ GAAGTAATCATTTTAGCAGAGCTTCATCTCTATTGACCAAAAACAAAAAAAGCATTGTAT
rJMFF024G18+ GAAGTAATCATTTTAGCAGAGCTTCATCTCTATTGACCAAAAACAAAAAAAGCATTGTAT
                      ____________________________________________________________
consensus GAAGTAATCATTTTAGCAGAGCTTCATCTCTATTGACCAAAAACAAAAAAAGCATTGTAT
 
. : . : . : . : . : . :
rJMSF021D16+ GATGATAAGAAAAATGAATTTTCATTATGTAACATTATGGAGTTGTGCAGGGATTCTAAA
rJMSF049F15+ GATGATAAGAAAAATGAATTTTCATTATGTAACATTATGGAGTTGTGCAGGGATTCTAAA
rJMFF024G18+ GATGATAAGAAAAATGAATTTTCATTATGTAACATTATGGAGTTGTGCAGGGATTCTAAA
                      ____________________________________________________________
consensus GATGATAAGAAAAATGAATTTTCATTATGTAACATTATGGAGTTGTGCAGGGATTCTAAA
 
. : . : . : . : . : . :
rJMSF021D16+ TCTAAAGTGTAGTAACTACTAGTATATGTATTTGAGTGACATA-CTGGTGTGGCT
rJMSF049F15+ TCTAAAGTGTAGTAACTACTAGTATATGTATTTGAGTGACATACCTGGTGTGGCT
rJMFF024G18+ TCTAAAGTGTAGTAACTACTAGTATATGTATTTGAGTGACATA-CTGGTGTGGCTTACTT
                      ____________________________________________________________
consensus TCTAAAGTGTAGTAACTACTAGTATATGTATTTGAGTGACATA-CTGGTGTGGCTTACTT