Previous Contig 009347:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017K07Sequence570001171 (5)gb:AE016959_10239816e-58Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02678009347 (5)gb:OSA495787_16926309e-52Oryza sativa (japonica cultivar-group) mRNA for TOM1 protein.>gb:AP004778_184493
JMFF024F19Sequence433001171 (5)pir|T51543|T515435e-29TOM (target of myb1)-like protein - Arabidopsis thaliana>gb:ATF2K13_1550492 Arab730009347 (5)pir|T51543|T515432e-53TOM (target of myb1)-like protein - Arabidopsis thaliana>gb:ATF2K13_1550492 Arab
JMFF040D13Sequence494001171 (5)gb:AE016959_10239812e-56Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02605009347 (5)gb:OSA495787_16926302e-47Oryza sativa (japonica cultivar-group) mRNA for TOM1 protein.>gb:AP004778_184493
JMSF019M06Sequence560001171 (5)gb:AE016959_10239817e-55Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02745009347 (5)pir|T51543|T515432e-54TOM (target of myb1)-like protein - Arabidopsis thaliana>gb:ATF2K13_1550492 Arab
JMSF023J22Sequence657001171 (5)gb:AE016959_10239811e-80Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02790009347 (5)gb:OSA495787_16926301e-57Oryza sativa (japonica cultivar-group) mRNA for TOM1 protein.>gb:AP004778_184493

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023J22+ AGATCTGTAGCAGCTTCAGAATTAAATGCCACT
                      ____________________________________________________________
consensus AGATCTGTAGCAGCTTCAGAATTAAATGCCACT
 
. : . : . : . : . : . :
rJMSF019M06+ AACAAATGCATAATGATGTCCCACCTCCTCCGACCTTGTCAGCTGAACAAACC
rJMSF023J22+ CTTGCACAACAAATGCATAATGATGTCCCACCTCCTCCGACCTTGTCAGCTGAACAAACC
rJMFF017K07+ C
rJMFF024F19+ TGAACAAACC
                      ____________________________________________________________
consensus CTTGCACAACAAATGCATAATGATGTCCCACCTCCTCCGACCTTGTCAGCTGAACAAACC
 
. : . : . : . : . : . :
rJMSF019M06+ AAGGAGGCATTTGATGTGGCAAGAAATAGTGTAGAGCTTCTTACCACTGTTTTATCCTCT
rJMSF023J22+ AAGGAGGCATTTGATGTGGCAAGAAATAGTGTAGAGCTTCTTACCACTGTTTTATCCTCT
rJMFF017K07+ AAGGAGGCATTTGATGTGGCAAGAAATAGTGTAGAGCTTCTTACCACTGTTTTATCCTCT
rJMFF024F19+ AAGGAGGCATTTGATGTGGCAAGAAATAGTGTAGAGCTTCTTACCACTGTTTTATCCTCT
                      ____________________________________________________________
consensus AAGGAGGCATTTGATGTGGCAAGAAATAGTGTAGAGCTTCTTACCACTGTTTTATCCTCT
 
. : . : . : . : . : . :
rJMSF019M06+ TCACCTCAACAAGATGCTTTAGAGGATGACTTGACAACTACGCTTGTACAACAGTGCCGC
rJMSF023J22+ TCACCTCAACAAGATGCTTTAGAGGATGACTTGACAACTACGCTTGTACAACAGTGCCGC
rJMFF040D13+ ACCTCAACAAGATGCTTTAGAGGATGACTTGACAACTACGCTTGTACAACAGTGCCGC
rJMFF017K07+ TCACCTCAACAAGATGCTTTAGAGGATGACTTGACAACTACGCTTGTACAACAGTGCCGC
rJMFF024F19+ TCACCTCAACAAGATGCTTTAGAGGATGACTTGACAACTACGCTTGTACAACAGTGCCGC
                      ____________________________________________________________
consensus TCACCTCAACAAGATGCTTTAGAGGATGACTTGACAACTACGCTTGTACAACAGTGCCGC
 
. : . : . : . : . : . :
rJMSF019M06+ CAGTCCCAAAATACTGTTCAGAGAATCATTGAGACTGCTGGAGATAATGAGGCCCTCCTT
rJMSF023J22+ CAGTCCCAAAATACTGTTCAGAGAATCATTGAGACTGCTGGAGATAATGAGGCCCTCCTT
rJMFF040D13+ CAGTCCCAAAATACTGTTCAGAGAATCATTGAGACTGCTGGAGATAATGAGGCCCTCCTT
rJMFF017K07+ CAGTCCCAAAATACTGTTCAGAGAATCATTGAGACTGCTGGAGATAATGAGGCCCTCCTT
rJMFF024F19+ CAGTCCCAAAATACTGTTCAGAGAATCATTGAGACTGCTGGAGATAATGAGGCCCTCCTT
                      ____________________________________________________________
consensus CAGTCCCAAAATACTGTTCAGAGAATCATTGAGACTGCTGGAGATAATGAGGCCCTCCTT
 
. : . : . : . : . : . :
rJMSF019M06+ TTTGAAGCTTTGAATGTGAATGATGAGATTCTGAAAGCCCTCTCAAAGTATGAAGAGATC
rJMSF023J22+ TTTGAAGCTTTGAATGTGAATGATGAGATTCTGAAAGCCCTCTCAAAGTATGAAGAGATC
rJMFF040D13+ TTTGAAGCTTTGAATGTGAATGATGAGATTCTGAAAGCCCTCTCAAAGTATGAAGAGATC
rJMFF017K07+ TTTGAAGCTTTGAATGTGAATGATGAGATTCTGAAAGCCCTCTCAAAGTATGAAGAGATC
rJMFF024F19+ TTTGAAGCTTTGAATGTGAATGATGAGATTCTGAAAGCCCTCTCAAAGTATGAAGAGATC
                      ____________________________________________________________
consensus TTTGAAGCTTTGAATGTGAATGATGAGATTCTGAAAGCCCTCTCAAAGTATGAAGAGATC
 
. : . : . : . : . : . :
rJMSF019M06+ ATAAAACCTGCAGTAGTTCCATCAGCACCGGAACCTGCTATGATACCCGTTGCTGTTGAG
rJMSF023J22+ ATAAAACCTGCAGTAGTTCCATCAGCACCGGAACCTGCTATGATACCCGTTGCTGTTGAG
rJMFF040D13+ ATAAAACCTGCAGTAGTTCCATCAGCACCGGAACCTGCTATGATACCCGTTGCTGTTGAG
rJMFF017K07+ ATAAAACCTGCAGTAGTTCCATCAGCACCGGAACCTGCTATGATACCCGTTGCTGTTGAG
rJMFF024F19+ ATAAAACCTGCAGTAGTTCCATCAGCACCGGAACCTGCTATGATACCCGTTGCTGTTGAG
                      ____________________________________________________________
consensus ATAAAACCTGCAGTAGTTCCATCAGCACCGGAACCTGCTATGATACCCGTTGCTGTTGAG
 
. : . : . : . : . : . :
rJMSF019M06+ CCTGATGAGTCCTCCTACGTGGGAAAGGAAGATTCTTTGATCCGAAAGCCTGCAGGCTCC
rJMSF023J22+ CCTGATGAGTCCTCCTACGTGGGAAAGGAAGATTCTTTGATCCGAAAGCCTGCAGGCTCC
rJMFF040D13+ CCTGATGAGTCCTCCTACGTGGGAAAGGAAGATTCTTTGATCCGAAAGCCTGCAGGCTCC
rJMFF017K07+ CCTGATGAGTCCTCCTACGTGGGAAAGGAAGATTCTTTGATCCGAAAGCCTGCAGGCTCC
rJMFF024F19+ CCTGATGAGTCCTCCTACGTGGGAAAGGAAGATTCTTTGATCCGAAAGCCTGCAGGCTCC
                      ____________________________________________________________
consensus CCTGATGAGTCCTCCTACGTGGGAAAGGAAGATTCTTTGATCCGAAAGCCTGCAGGCTCC
 
. : . : . : . : . : . :
rJMSF019M06+ CGTCCTGGCGCTCACAATGGACCCAATGATGAAATGATGGACGATCTTGATGAGATGATC
rJMSF023J22+ CGTCCTGGCGCTCACAATGGACCCAATGATGAAATGATGGACGATCTTGATGAGATGATC
rJMFF040D13+ CGTCCTGGCGCTCACAATGGACCCAATGATGAAATGATGGACGATCTTGATGAGATGATC
rJMFF017K07+ CGTCCTGGCGCTCACAATGGACCCAATGATGAAATGATGGACGATCTTGATGAGATGATC
rJMFF024F19+ CGTCCTGGCGCTCACAATGGACCCAATGATGAAATGATGGACGATCTTGATGAGATGATC
                      ____________________________________________________________
consensus CGTCCTGGCGCTCACAATGGACCCAATGATGAAATGATGGACGATCTTGATGAGATGATC
 
. : . : . : . : . : . :
rJMSF019M06+ TTTGGTAAAAAAGCGGGTGGTTCATCTGAATCAGGGCACGATCAAAAGAAGCAGCAACCA
rJMSF023J22+ TTTGGTAAAAAAGCGGGTGGTTCATCTGAATCAGGGCACGATCAAAAGAAGCAGCAACCA
rJMFF040D13+ TTTGGTAAAAAAGCGGGTGGTTCATCTGAATCAGGGCACGATCAAAAGAAGCAGCAACCA
rJMFF017K07+ TTTGGTAAAAAAGCGGGTGGTTCATCTGAATCAGGGCACGATCAAAAGAAGCAGCAACCA
rJMFF024F19+ TTTGGTAAAAAAGCGGGTGGTTCATCTGAATCAGGGCACGATCAAAAGAAGCAGCAACCA
                      ____________________________________________________________
consensus TTTGGTAAAAAAGCGGGTGGTTCATCTGAATCAGGGCACGATCAAAAGAAGCAGCAACCA
 
. : . : . : . : . : . :
rJMSF019M06+ CCAAAAGATGATCTCATTTCCTTTTAAGTTTCCTCAGCAGCGCTGGATTATATTTGAAAA
rJMSF023J22+ CCAAAAGATGATCTCATTTCCTTTTAAGTTTCCTCAGCAGCGCTGGATTATATTTGAAAA
rJMFF040D13+ CCAAAAGATGATCTCATTTCCTTTTAAGTTTCCTCAGCAGCGCTGGATTATATTTGAAAA
rJMFF017K07+ CCAAAAGATGATCTCATTTCCTTTTAAGTTTCCTCAGCAGCGCTGGATTATATTTGAAAA
rJMFF024F19+ CCAAAAGATGATCTCATTTCCTTTTAAGTTTCCTCAGCAGCGCTGGATTATATTTGAAAA
                      ____________________________________________________________
consensus CCAAAAGATGATCTCATTTCCTTTTAAGTTTCCTCAGCAGCGCTGGATTATATTTGAAAA
 
. : . : . : . : . : . :
rJMSF019M06+ CCTGTCTTTGCTGGTGTTAATACGATTGGCTTTTAGATGGTATTGGCAGATCGTTCAATC
rJMSF023J22+ CCTGTCTTTGCTGGTGTTAATACGATTGGCTTTTAGATGGTATTGGCAGATCGTTCAATC
rJMFF040D13+ CCTGTCTTTGCTGGTGTTAATACGATTGGCTTTTAGATGGTATTGGCAGATCGTTCAATC
rJMFF017K07+ CCTGTCTTTGCTGGTGTTAATACGATTGGCTTTTAGATGGTATTGGCAGATCGTTCAATC
rJMFF024F19+ CCTGTCTTTGCTGGTGTTAATACGATTGGCTTTTAGATGGTATTGGCAGATCGTTCAATC
                      ____________________________________________________________
consensus CCTGTCTTTGCTGGTGTTAATACGATTGGCTTTTAGATGGTATTGGCAGATCGTTCAATC
 
. : . : . : . : . : . :
rJMSF019M06+ ATTATGTCTTTCTAAAGGAACCCGACAATTTGTCTTTCTCTTTTCACTAACATTTGAACT
rJMSF023J22+ ATTATGTCTTTCTAAAGGAACCCGACAATTTGTCTTTCTCTTTTCACTAACATTTGAACT
rJMFF040D13+ ATTATGTCTTTCTAAAGGAACCCGACAATTTGTCTTTCTCTTTTCACTAACATTTGAACT
rJMFF017K07+ ATTATGTCTTTCTAAAGGAACCCGACAATTTGTCTTTCTCTTTTCACTAACATTTGAACT
rJMFF024F19+ ATTATGTCTTTCTAAAGGAACCCGACAATTTGTCTTTCTCTTTTCACTAACATTTGAACT
                      ____________________________________________________________
consensus ATTATGTCTTTCTAAAGGAACCCGACAATTTGTCTTTCTCTTTTCACTAACATTTGAACT
 
. : . : . : . : . : . :
rJMSF019M06+ ACTGCTATTTCGACTTTTTATGTTTGATGAAC
rJMSF023J22+ ACTGCTATTTCGACTTTTTATGTTTGATGAAC
rJMFF040D13+ ACTGCTA
rJMFF017K07+ ACTGCTATTTCGAC
rJMFF024F19+ ACTGCTATTTCGACTTTTTATGTTTGATGAACTTGGATTCAATTGCTGAAGATACAGGAG
                      ____________________________________________________________
consensus ACTGCTATTTCGACTTTTTATGTTTGATGAACTTGGATTCAATTGCTGAAGATACAGGAG