Previous Contig 009345:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024E17Sequence543001170 (3)771009345 (2)pir|A84693|A846933e-43hypothetical protein At2g29140 [imported] - Arabidopsis thaliana>gb:AC004561_153
JMFF040L03Sequence531001170 (3)pir|A84693|A846933e-31hypothetical protein At2g29140 [imported] - Arabidopsis thaliana>gb:AC004561_153768009345 (2)pir|A84693|A846931e-71hypothetical protein At2g29140 [imported] - Arabidopsis thaliana>gb:AC004561_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF040L03+ TAAAGTCATGGAAGAGATTCTAGGATCTGTAAGCACATTGGCACAGGA
                      ____________________________________________________________
consensus TAAAGTCATGGAAGAGATTCTAGGATCTGTAAGCACATTGGCACAGGA
 
. : . : . : . : . : . :
rJMFF040L03+ TCAGTATGGTAATTATGTTGTACAGCATGTNCTGGAGCATGGAAAGCCGCATGAGAGGTC
                      ____________________________________________________________
consensus TCAGTATGGTAATTATGTTGTACAGCATGTNCTGGAGCATGGAAAGCCGCATGAGAGGTC
 
. : . : . : . : . : . :
rJMFF040L03+ TACTATTATTAAGGAATTAGCTGGTAACATTGTTCAGATGAGCCAGCAGAAGTTCGCTTC
                      ____________________________________________________________
consensus TACTATTATTAAGGAATTAGCTGGTAACATTGTTCAGATGAGCCAGCAGAAGTTCGCTTC
 
. : . : . : . : . : . :
rJMFF040L03+ AAATGTTGTAGAGAAATGCTTGACATTCGGTAATGCTAGTGAAAGACAACTTCTCGTGAA
rJMFF024E17+ AGAGAAATGCTTGACATTCGGTAATGCTAGTGAAAGACAACTTCTCGTGAA
                      ____________________________________________________________
consensus AAATGTTGTAGAGAAATGCTTGACATTCGGTAATGCTAGTGAAAGACAACTTCTCGTGAA
 
. : . : . : . : . : . :
rJMFF040L03+ TGAGATGCTTGGCACAACTGATGAAANTGAGCCACTTCAGGCGATGATGAAAGATCAGTT
rJMFF024E17+ TGAGATGCTTGGCACAACTGATGAAAATGAGCCACTTCAGGCGATGATGAAAGATCAGTT
                      ____________________________________________________________
consensus TGAGATGCTTGGCACAACTGATGAAAATGAGCCACTTCAGGCGATGATGAAAGATCAGTT
 
. : . : . : . : . : . :
rJMFF040L03+ TGCAAATTACGTCGTACAAAAAGTTTTGGAAACTTGCAGTGATCAGGAGCGTGAACTGAT
rJMFF024E17+ TGCAAATTACGTCGTACAAAAAGTTTTGGAAACTTGCAGTGATCAGGAGCGTGAACTGAT
                      ____________________________________________________________
consensus TGCAAATTACGTCGTACAAAAAGTTTTGGAAACTTGCAGTGATCAGGAGCGTGAACTGAT
 
. : . : . : . : . : . :
rJMFF040L03+ CCTTTCACGCATAAAAGTCCACTTGAATGCATTGAAGAAATACACCTACGGGAAGCACAT
rJMFF024E17+ CCTTTCACGCATAAAAGTCCACTTGAATGCATTGAAGAAATACACCTACGGGAAGCACAT
                      ____________________________________________________________
consensus CCTTTCACGCATAAAAGTCCACTTGAATGCATTGAAGAAATACACCTACGGGAAGCACAT
 
. : . : . : . : . : . :
rJMFF040L03+ TGTTGCACGTGTTGAGAAACTCGTTGCTGCCGGGGAAAGGAGAATGGCTGCTCAGACTCC
rJMFF024E17+ TGTTGCACGTGTTGAGAAACTCGTTGCTGCCGGGGAAAGGAGAATGGCTGCTCAGACTCC
                      ____________________________________________________________
consensus TGTTGCACGTGTTGAGAAACTCGTTGCTGCCGGGGAAAGGAGAATGGCTGCTCAGACTCC
 
. : . : . : . : . : . :
rJMFF040L03+ AAATCCCGCATAGATCTTCATAGAAAAGAAAGATGTACAGCTAACCGAGGCTAGTTTGAG
rJMFF024E17+ AAATCCCGCATAGATCTTCATAGAAAAGAAAGATGTACAGCTAACCGAGGCTAGTTTGAG
                      ____________________________________________________________
consensus AAATCCCGCATAGATCTTCATAGAAAAGAAAGATGTACAGCTAACCGAGGCTAGTTTGAG
 
. : . : . : . : . : . :
rJMFF040L03+ CTGCCTCTCTCCCTTTCTTTTCTCGATACCTAGTTCTCTGGCTCCTCCGTGCCCTTGTTC
rJMFF024E17+ CTGCCTCTCTCCCTTTCTTTTCTCGATACCTAGTTCTCTGGCTCCTCCGTGCCCTTGTTC
                      ____________________________________________________________
consensus CTGCCTCTCTCCCTTTCTTTTCTCGATACCTAGTTCTCTGGCTCCTCCGTGCCCTTGTTC
 
. : . : . : . : . : . :
rJMFF040L03+ CGTGATCTGTGATTGCAAATAAAGTTGTTGCTCCTACTAGAGATCTGTACATTATGTAGC
rJMFF024E17+ CGTGATCTGTGATTGCAAATAAAGTTGTTGCTCCTACTAGAGATCTGTACATTATGTAGC
                      ____________________________________________________________
consensus CGTGATCTGTGATTGCAAATAAAGTTGTTGCTCCTACTAGAGATCTGTACATTATGTAGC
 
. : . : . : . : . : . :
rJMFF040L03+ TTAAAGAAGTCTCTATACACAGAACTAAGTAAAGCTAAAAGCCAGGCTGTTACATATTCT
rJMFF024E17+ TTAAAGAAGTCTCTATACACAGAACTAAGTAAAGCTAAAAGCCAGGCTGTTACATATTCT
                      ____________________________________________________________
consensus TTAAAGAAGTCTCTATACACAGAACTAAGTAAAGCTAAAAGCCAGGCTGTTACATATTCT
 
. : . : . : . : . : . :
rJMFF040L03+ GATGGCTGTTGCAGAGGAAGTGAAGCTTCTATTATAAACCATGTAAAAATGATACCAACC
rJMFF024E17+ GATGGCTGTTGCAGAGGAAGTGAAGCTTCTATTATAAACCATGTAAAAATGATACCAACC
                      ____________________________________________________________
consensus GATGGCTGTTGCAGAGGAAGTGAAGCTTCTATTATAAACCATGTAAAAATGATACCAACC
 
. : . : . : . : . : . :
rJMFF024E17+ TGGCCATAGTAGTTTTTATATGATCAACGTGACTGTACAAATGTTACCATGTTGAGAGAT
                      ____________________________________________________________
consensus TGGCCATAGTAGTTTTTATATGATCAACGTGACTGTACAAATGTTACCATGTTGAGAGAT
 
. : . : . : . : . : . :
rJMFF024E17+ ATGATGTTTTAGGCATGGCTGGCCAGAGTTTTCATGTATGCTACTTAGTATTTATCATGT
                      ____________________________________________________________
consensus ATGATGTTTTAGGCATGGCTGGCCAGAGTTTTCATGTATGCTACTTAGTATTTATCATGT
 
. : . : . : . : . : . :
rJMFF024E17+ TCTTTTAATGCTGAGTTATATGTTTTGTATGCCTCAATCTTATATGCTAAAAGCCCAAAA
                      ____________________________________________________________
consensus TCTTTTAATGCTGAGTTATATGTTTTGTATGCCTCAATCTTATATGCTAAAAGCCCAAAA