Previous Contig 009332:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019O08Sequence456001161 (3)pir|G84823|G848238e-35probable anthocyanin 5-aromatic acyltransferase [imported] - Arabidopsis thalian714009332 (3)pir|G84823|G848235e-80probable anthocyanin 5-aromatic acyltransferase [imported] - Arabidopsis thalian
JMFF023P12Sequence437001161 (3)pir|G84823|G848231e-30probable anthocyanin 5-aromatic acyltransferase [imported] - Arabidopsis thalian657009332 (3)pir|G84823|G848232e-72probable anthocyanin 5-aromatic acyltransferase [imported] - Arabidopsis thalian
JMFF048D16Sequence410009332 (3)pir|G84823|G848232e-43probable anthocyanin 5-aromatic acyltransferase [imported] - Arabidopsis thalian

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF019O08+ TTACAAAACCCGAGAAACCCGGGGAGGAGATTT
                      ____________________________________________________________
consensus TTACAAAACCCGAGAAACCCGGGGAGGAGATTT
 
. : . : . : . : . : . :
rJMFF019O08+ CGTCGTTTCAGTCTNTATGCGCTTTANTATGGCGGGCGGTGACACGTGCGAGGAACCTGC
                      ____________________________________________________________
consensus CGTCGTTTCAGTCTNTATGCGCTTTANTATGGCGGGCGGTGACACGTGCGAGGAACCTGC
 
. : . : . : . : . : . :
rJMFF019O08+ CGGCGTCCAAAACGACGACGTTCCGGATGGCCGTGAACACCCGCCACCAGACTCGACCCG
rJMFF023P12+ GGCGTCCAAAACGACGACGTTCCGGATGGCCGTGAACACCCGCCA-CAGACTCGACCCG
                      ____________________________________________________________
consensus CGGCGTCCAAAACGACGACGTTCCGGATGGCCGTGAACACCCGCCACCAGACTCGACCCG
 
. : . : . : . : . : . :
rJMFF019O08+ AAACTCAACCCGCTCTACTTCGGCAACGCCATACAGAGCATCCCGACATACGCCGCCGCC
rJMFF023P12+ AAACTCAACCCGCTCTACTTCGGCAACGCCATACAGAGCATCCCGACATACGCCGCCGCC
                      ____________________________________________________________
consensus AAACTCAACCCGCTCTACTTCGGCAACGCCATACAGAGCATCCCGACATACGCCGCCGCC
 
. : . : . : . : . : . :
JMFF048D16+ TGCGCCGAGCAACTGAACAAGAACGTGAAG
rJMFF019O08+ GGCGACGTCCTGTCACGTGACCTCCGGTGGTGCGCCGAGCAACTGAACAAGAACGTGAAG
rJMFF023P12+ GGCGACGTCCTGTCACGTGACCTCCGGTGGTGCGCCGAGCAACTGAACAAGAACGTGAAG
                      ____________________________________________________________
consensus GGCGACGTCCTGTCACGTGACCTCCGGTGGTGCGCCGAGCAACTGAACAAGAACGTGAAG
 
. : . : . : . : . : . :
JMFF048D16+ GCCCACGACGGCGATATGGTCAGGAAGTACGTAGAGGCCTGGGAAAGCGAGCCGCGGTGT
rJMFF019O08+ GCCCACGACGGCGATATGGTCAGGAAGTACGTAGAGGCCTGGGAAAGCGAGCCGCGGTGT
rJMFF023P12+ GCCCACGACGGCGATATGGTCAGGAAGTACGTAGAGGCCTGGGAAAGCGAGCCGCGGTGT
                      ____________________________________________________________
consensus GCCCACGACGGCGATATGGTCAGGAAGTACGTAGAGGCCTGGGAAAGCGAGCCGCGGTGT
 
. : . : . : . : . : . :
JMFF048D16+ TTTCCGTTGGGGAATTTCGACGGCGCCATGCTCACAATGGGCAGCTCGCCGAGATTCCCA
rJMFF019O08+ TTTCCGTTGGGGAATTTCGACGGCGCCATGCTCACAATGGGCAGCTCGCCGAGATTCCCA
rJMFF023P12+ TTTCCGTTGGGGAATTTCGACGGCGCCATGCTCACAATGGGCAGCTCGCCGAGATTCCCA
                      ____________________________________________________________
consensus TTTCCGTTGGGGAATTTCGACGGCGCCATGCTCACAATGGGCAGCTCGCCGAGATTCCCA
 
. : . : . : . : . : . :
JMFF048D16+ ATGTACGACAACGATTTCGGGTGGGGCAGACCCGTCGCCGTGCGGAGCGGGAGAGCCAAC
rJMFF019O08+ ATGTACGACAACGATTTCGGGTGGGGCAGACCCGTCGCCGTGCGGAGCGGGAGAGCCAAC
rJMFF023P12+ ATGTACGACAACGATTTCGGGTGGGGCAGACCCGTCGCCGTGCGGAGCGGGAGAGCCAAC
                      ____________________________________________________________
consensus ATGTACGACAACGATTTCGGGTGGGGCAGACCCGTCGCCGTGCGGAGCGGGAGAGCCAAC
 
. : . : . : . : . : . :
JMFF048D16+ AAGTTCGACGGCAAGATTTCGGCTTTCCCCGGCCGGGAAGGCGGCGGGACAGTGGATTTG
rJMFF019O08+ AAGTTCGACGGCAAGATTTCGGCTTTCCCCGGCCGGGAAGGCGGCGGGACAGTGGATTTG
rJMFF023P12+ AAGTTCGACGGCAAGATTTCGGCTTTCCCCGGCCGGGAAGGCGGCGGGACAGTGGATTTG
                      ____________________________________________________________
consensus AAGTTCGACGGCAAGATTTCGGCTTTCCCCGGCCGGGAAGGCGGCGGGACAGTGGATTTG
 
. : . : . : . : . : . :
JMFF048D16+ GAGCTGATTTTGACGCCGGAAACAATGGCGGGGCTGGAGTTCCGACCCGGAGTTCATGCA
rJMFF019O08+ GAGGTGATTTTGACGCCGGAAACAATGGCGGGGCTGGAG-TCCGACCCGGAGTTCATGCA
rJMFF023P12+ GAGGTGATTTTGACGCCGGAAACAATGGCGGGGCTGGAG-TCCGACCCGGAGTTCATGCA
                      ____________________________________________________________
consensus GAGGTGATTTTGACGCCGGAAACAATGGCGGGGCTGGAG-TCCGACCCGGAGTTCATGCA
 
. : . : . : . : . : . :
JMFF048D16+ ATATGTATCGGGTTATTAAAACGGGTTTGGGAATAAAAACACCCAAAATAGTTTCTTTTG
rJMFF019O08+ ATATGTATCGGGTTATTAAAACGGGTTTGGGAATAAAAACACCCAAAATAGTTTCTTTTG
rJMFF023P12+ ATATGTATCGGGTTATTAAAACGGGTTTGGGAATAAAAACACCCAAAATAGTTTCTTTTG
                      ____________________________________________________________
consensus ATATGTATCGGGTTATTAAAACGGGTTTGGGAATAAAAACACCCAAAATAGTTTCTTTTG
 
. : . : . : . : . : . :
JMFF048D16+ TTGTTGGGTCTTACTCTAAT
rJMFF019O08+ TTGTTGGGTCTTACTCTAATGGGAAAGTTATTAATTTTTAGCTTTATTATATGTATAATG
rJMFF023P12+ TTGTTGGGTCTTACTCTAATGGGAAAGTTATTAATTTTTAGCTTTATTATATGTATAATG
                      ____________________________________________________________
consensus TTGTTGGGTCTTACTCTAATGGGAAAGTTATTAATTTTTAGCTTTATTATATGTATAATG
 
. : . : . : . : . : . :
rJMFF019O08+ TAATGTAAGTAACAACAAAAT
rJMFF023P12+ TAATGTAAGTAACAACAAAATGTCAATGATGTTCATTAACGGCTTTTGTCATTATCCACT
                      ____________________________________________________________
consensus TAATGTAAGTAACAACAAAATGTCAATGATGTTCATTAACGGCTTTTGTCATTATCCACT