Previous Contig 009328:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023O02Sequence496009328 (2)pir|S19159|S191591e-20finger protein EPF1 - garden petunia>gb:PHEPF1_1700108 P.hybrida EPF1 gene for D759009328 (2)pir|S19159|S191596e-45finger protein EPF1 - garden petunia>gb:PHEPF1_1700108 P.hybrida EPF1 gene for D

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF023O02- ACCCCGGCTCTCCAATTCTTATATCTTTCA
                      ____________________________________________________________
consensus ACCCCGGCTCTCCAATTCTTATATCTTTCA
 
. : . : . : . : . : . :
JMFF023O02- AGGCTGCTCTGATCATCGATCTTCACTTTTCTTTTGGCTGTTTTTAGGCACTATTATGGA
                      ____________________________________________________________
consensus AGGCTGCTCTGATCATCGATCTTCACTTTTCTTTTGGCTGTTTTTAGGCACTATTATGGA
 
. : . : . : . : . : . :
JMFF023O02- AATCTCTCAAGAATATTCCGATTATCAGATGGTGTTGATAAAAGGAAAGCGTACTAAACG
                      ____________________________________________________________
consensus AATCTCTCAAGAATATTCCGATTATCAGATGGTGTTGATAAAAGGAAAGCGTACTAAACG
 
. : . : . : . : . : . :
JMFF023O02- TCCGAGGGGATTGTCGCCGGCTGACTCGAGCTGTTCTAGCGGCGGCGGGGATGGTGGTGC
                      ____________________________________________________________
consensus TCCGAGGGGATTGTCGCCGGCTGACTCGAGCTGTTCTAGCGGCGGCGGGGATGGTGGTGC
 
. : . : . : . : . : . :
JMFF023O02- TGCTGCTGTTTTCTATTCCTCCTCCGCTCAGTACTCTCCGGCGACTTCGACTAGCCAGAT
rJMFF023O02+ CTCCGCTCAGTACTNTCCGGCGACTTCGACTAGCCAGAT
                      ____________________________________________________________
consensus TGCTGCTGTTTTCTATTCCTCCTCCGCTCAGTACTCTCCGGCGACTTCGACTAGCCAGAT
 
. : . : . : . : . : . :
JMFF023O02- ATCCGCCACCACCAACGATGAGGATGAGGACATGGCGAATTGTCTGATTCTTTTGGCACG
rJMFF023O02+ ATCCGCCACCACCAACGATGAGGATGAGGACATGGCGAATTGTCTGATTCTTTTGGCACG
                      ____________________________________________________________
consensus ATCCGCCACCACCAACGATGAGGATGAGGACATGGCGAATTGTCTGATTCTTTTGGCACG
 
. : . : . : . : . : . :
JMFF023O02- AGGCGGTGGATGCCGTCAAGTAGAGAGAGTTAGTGGCAGCCGGAAAGTCGACGAAATGGC
rJMFF023O02+ AGGCGGTGGATGCCGTCAAGTAGAGAGAGTTAGTGGCAGCCGGAAAGTCGACGAAATGGC
                      ____________________________________________________________
consensus AGGCGGTGGATGCCGTCAAGTAGAGAGAGTTAGTGGCAGCCGGAAAGTCGACGAAATGGC
 
. : . : . : . : . : . :
JMFF023O02- CGCCGCCGCCGCAGGCGCCGGCAAGGGTGGTGGCGATTTATACGTCTATCAGTGCAAAAC
rJMFF023O02+ CGCCGCCGCCGCAGGCGCCGGCAAGGGTGGTGGCGATTTATACGTCTATCAGTGCAAAAC
                      ____________________________________________________________
consensus CGCCGCCGCCGCAGGCGCCGGCAAGGGTGGTGGCGATTTATACGTCTATCAGTGCAAAAC
 
. : . : . : . : . : . :
JMFF023O02- TTGTAACCGAACTTTCCCGTCGTTTCAAGCTCTGGGTGGGCATAGA
rJMFF023O02+ TTGTAACCGAACTTTCCCGTCGTTTCAAGCTCTGGGTGGGCATAGAGCCAGCCACAAGAA
                      ____________________________________________________________
consensus TTGTAACCGAACTTTCCCGTCGTTTCAAGCTCTGGGTGGGCATAGAGCCAGCCACAAGAA
 
. : . : . : . : . : . :
rJMFF023O02+ ACCTAAGATCACTGCGGCAGACGATCAGAAAAAATCGGCGGCGCCGTCGTCGTCAGACTT
                      ____________________________________________________________
consensus ACCTAAGATCACTGCGGCAGACGATCAGAAAAAATCGGCGGCGCCGTCGTCGTCAGACTT
 
. : . : . : . : . : . :
rJMFF023O02+ TGATAAACAAAGTTCGCCGCTTTTCGCCGCCGGGGTTTCTACCCATACCCTCAGCAATGG
                      ____________________________________________________________
consensus TGATAAACAAAGTTCGCCGCTTTTCGCCGCCGGGGTTTCTACCCATACCCTCAGCAATGG
 
. : . : . : . : . : . :
rJMFF023O02+ CGGCAAGGCCAAGATTCACGAGTGTTCGATCTGCGGGTCGGAGTTCTCGTCGGGGCAAGC
                      ____________________________________________________________
consensus CGGCAAGGCCAAGATTCACGAGTGTTCGATCTGCGGGTCGGAGTTCTCGTCGGGGCAAGC
 
. : . : . : . : . : . :
rJMFF023O02+ TCTGGGAGGTCACATGAGAAGACACCGGCCGCCGCCTACTATCAACCCGGCGAAGCCGCT
                      ____________________________________________________________
consensus TCTGGGAGGTCACATGAGAAGACACCGGCCGCCGCCTACTATCAACCCGGCGAAGCCGCT
 
. : . : . : . : . : . :
rJMFF023O02+ CTCGGTGATTAGCGACGGCGGAACGGCCAACGTTTCTGAATCATCGGACCGCCGAGAGAA
                      ____________________________________________________________
consensus CTCGGTGATTAGCGACGGCGGAACGGCCAACGTTTCTGAATCATCGGACCGCCGAGAGAA
 
. : . : . : . : . : . :
rJMFF023O02+ GGCGGCGACAGGCGGCGGGGGTGTTTTCACGCTCGATCTTAACCTGGCGGCTCCACTAGA
                      ____________________________________________________________
consensus GGCGGCGACAGGCGGCGGGGGTGTTTTCACGCTCGATCTTAACCTGGCGGCTCCACTAGA
 
. : . : . : . : . : . :
rJMFF023O02+ AGATGATGATGACGATCAAGAAACCAAGTTACAAAATCTTGCGTTTTCCACCCCGGCTTT
                      ____________________________________________________________
consensus AGATGATGATGACGATCAAGAAACCAAGTTACAAAATCTTGCGTTTTCCACCCCGGCTTT
 
. : . : . : . : . : . :
rJMFF023O02+ GGTGGACTGTCATTACTGAAACCGATCAGATAATACAATACATAGTGATATTGAATTATT
                      ____________________________________________________________
consensus GGTGGACTGTCATTACTGAAACCGATCAGATAATACAATACATAGTGATATTGAATTATT