Previous Contig 009327:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023N22Sequence436003055 (5)pir|D96836|D968361e-53probable glycerol kinase, 69575-71670 [imported] - Arabidopsis thaliana>gb:AE005777009327 (3)gb:AY496707_16091239e-46Pandanus amaryllifolius glycerol kinase (GK) mRNA, complete cds.
JMSF014I14Sequence551003055 (5)pir|D96836|D968364e-74probable glycerol kinase, 69575-71670 [imported] - Arabidopsis thaliana>gb:AE005796009327 (3)gb:AY496707_16091234e-47Pandanus amaryllifolius glycerol kinase (GK) mRNA, complete cds.
JMSF041K15Sequence715003055 (5)pir|D96836|D96836e-101probable glycerol kinase, 69575-71670 [imported] - Arabidopsis thaliana>gb:AE005750009327 (3)pir|D96836|D968361e-89probable glycerol kinase, 69575-71670 [imported] - Arabidopsis thaliana>gb:AE005

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041K15+ CCAATT
                      ____________________________________________________________
consensus CCAATT
 
. : . : . : . : . : . :
rJMSF041K15+ ACGCTTTGGAGGGCTCGANTGCCATTGCTGGTGCTGCTGTTCAGTGGCTCAGGGATAGTC
                      ____________________________________________________________
consensus ACGCTTTGGAGGGCTCGANTGCCATTGCTGGTGCTGCTGTTCAGTGGCTCAGGGATAGTC
 
. : . : . : . : . : . :
rJMSF041K15+ TCAACTTAATCAGCAGCGCAAGTGAGATTGAGCAGCTGGCGTCGAAGGTGGAATCAACCG
                      ____________________________________________________________
consensus TCAACTTAATCAGCAGCGCAAGTGAGATTGAGCAGCTGGCGTCGAAGGTGGAATCAACCG
 
. : . : . : . : . : . :
rJMSF041K15+ GGGGAGTTTATTTTGTGCCAGCTTTTAATGGGTTGTTTGCTCCGTGGTGGCGGGATGATG
                      ____________________________________________________________
consensus GGGGAGTTTATTTTGTGCCAGCTTTTAATGGGTTGTTTGCTCCGTGGTGGCGGGATGATG
 
. : . : . : . : . : . :
rJMSF041K15+ CTCGGGGAGTTTGTATTGGAATCACGAGGTTTACTAACAAGTGTCACATTGCTCGAGCGG
rJMSF014I14+ TCACGAGGTTTACTAACAAGTGTCACA-TGCTCGAGCGG
                      ____________________________________________________________
consensus CTCGGGGAGTTTGTATTGGAATCACGAGGTTTACTAACAAGTGTCACATTGCTCGAGCGG
 
. : . : . : . : . : . :
rJMSF041K15+ TTCTTGAGAGCATGTGTTTTCAAGTTCGAGATGTGCTGGATTCAATGCACAAGGACGCTG
rJMSF014I14+ TTCNTGAGAGCATGTGTTTTCAAGTTCGAGATGTGCTGGATTCAATGCACAAGGACGCTG
rJMFF023N22+ GAGAGCATGTGTTTTCAAGTTCGAGATGTGCTGGATTCAATGCACAAGGACGCTG
                      ____________________________________________________________
consensus TTCTTGAGAGCATGTGTTTTCAAGTTCGAGATGTGCTGGATTCAATGCACAAGGACGCTG
 
. : . : . : . : . : . :
rJMSF041K15+ GGGATAAAGGTGAGGTTAAAAATGATCGAGGGGAATTCGTTCTTAGAGTTGATGGTGGTG
rJMSF014I14+ GGGATAAAGGTGAGGTTAAAAATGATCGAGGGGAATTCGTTCTTAGAGTTGATGGTGGTG
rJMFF023N22+ GGGATAAAGGTGAGGTTAAAAATGATCGAGGGGAATTCGTTCTTAGAGTTGATGGTGGTG
                      ____________________________________________________________
consensus GGGATAAAGGTGAGGTTAAAAATGATCGAGGGGAATTCGTTCTTAGAGTTGATGGTGGTG
 
. : . : . : . : . : . :
rJMSF041K15+ CTACTGTTAACAATCTTCTGATGCAGATTCAGGCGGATTTGTTGGGTAGTCCAGTGGTGA
rJMSF014I14+ CTACTGTTAACAATCTTCTGATGCAGATTCAGGCGGATTTGTTGGGTAGTCCAGTGGTGA
rJMFF023N22+ CTACTGTTAACAATCTTCTGATGCAGATTCAGGCGGATTTGTTGGGTAGTCCAGTGGTGA
                      ____________________________________________________________
consensus CTACTGTTAACAATCTTCTGATGCAGATTCAGGCGGATTTGTTGGGTAGTCCAGTGGTGA
 
. : . : . : . : . : . :
rJMSF041K15+ GGCCAGCGGACATAGAGACAACAGCCCTCGGGGCAGCATATGCTGCTGGATTAGCTGTTG
rJMSF014I14+ GGCCAGCGGACATAGAGACAACAGCCCTCGGGGCAGCATATGCTGCTGGATTAGCTGTTG
rJMFF023N22+ GGCCAGCGGACATAGAGACAACAGCCCTCGGGGCAGCATATGCTGCTGGATTAGCTGTTG
                      ____________________________________________________________
consensus GGCCAGCGGACATAGAGACAACAGCCCTCGGGGCAGCATATGCTGCTGGATTAGCTGTTG
 
. : . : . : . : . : . :
rJMSF041K15+ GGATATGGACAGAAGACGAAATATTTTCCAGCGGTGAGAAAATGAAGAAGGACACCATTT
rJMSF014I14+ GGATATGGACAGAAGACGAAATATTTTCCAGCGGTGAGAAAATGAAGAAGGACACCATTT
rJMFF023N22+ GGATATGGACAGAAGACGAAATATTTTCCAGCGGTGAGAAAATGAAGAAGGACACCATTT
                      ____________________________________________________________
consensus GGATATGGACAGAAGACGAAATATTTTCCAGCGGTGAGAAAATGAAGAAGGACACCATTT
 
. : . : . : . : . : . :
rJMSF041K15+ TCAAACCAGTGATCGAGGAAGAAGTGAGGAAGAAGAAGGTGGATTCTTGGTGCAAAGCTG
rJMSF014I14+ TCAAACCAGTGATCGAGGAAGAAGTGAGGAAGAAGAAGGTGGATTCTTGGTGCAAAGCTG
rJMFF023N22+ TCAAACCAGTGATCGAGGAAGAAGTGAGGAAGAAGAAGGTGGATTCTTGGTGCAAAGCTG
                      ____________________________________________________________
consensus TCAAACCAGTGATCGAGGAAGAAGTGAGGAAGAAGAAGGTGGATTCTTGGTGCAAAGCTG
 
. : . : . : . : . : . :
rJMSF041K15+ TTTCAAGAACTTTCGACTTGGCTGATCTATCTTTGTAACTGAATTCTCTTCTTTCCTTTC
rJMSF014I14+ TTTCAAGAACTTTCGACTTGGCTGATCTATCTTTGTAACTGAATTCTCTTCTTTCCTTTC
rJMFF023N22+ TTTCAAGAACTTTCGACTTGGCTGATCTATCTTTGTAACTGAATTCTCTTCTTTCCTTTC
                      ____________________________________________________________
consensus TTTCAAGAACTTTCGACTTGGCTGATCTATCTTTGTAACTGAATTCTCTTCTTTCCTTTC
 
. : . : . : . : . : . :
rJMSF041K15+ AGTACCTATACATTCTTGTTTATATCAGTTAGCAATGTTCTCCCATTACCTCAAGATAAA
rJMSF014I14+ AGTACCTATACATTCTTGTTTATATCAGTTA-CAATGTTCTCCCATTACCTCAAGAT-AA
rJMFF023N22+ AGTACCTATACATTCTTGTTTATATCAGTTA-CAATGTTCTCCCATTACCTCAAGAT-AA
                      ____________________________________________________________
consensus AGTACCTATACATTCTTGTTTATATCAGTTA-CAATGTTCTCCCATTACCTCAAGAT-AA
 
. : . : . : . : . : . :
rJMSF041K15+ CCGTTGGTCTTTGAC
rJMSF014I14+ CCGTTGGTCTTTGACTATATATATAGTAGCAATAACAGAACTAGTTTTTAACTTTCGATT
rJMFF023N22+ CCGTTGGTCTTTGACTATATATATAGTAGCAATAACAGAACTAGTTTTTAACTTTCGATT
                      ____________________________________________________________
consensus CCGTTGGTCTTTGACTATATATATAGTAGCAATAACAGAACTAGTTTTTAACTTTCGATT
 
. : . : . : . : . : . :
rJMSF014I14+ TTGACACATTGAGTATTGTTTCACATTCAGCGAAAAATGTCCTCGCTTTGCAGACATTTA
rJMFF023N22+ TTGACACATTGAGTATTGTTTCACATTCAGCGAAAAATGTCCTCGCTTTGCAGACATTTA
                      ____________________________________________________________
consensus TTGACACATTGAGTATTGTTTCACATTCAGCGAAAAATGTCCTCGCTTTGCAGACATTTA
 
. : . : . : . : . : . :
rJMSF014I14+ ACCAAACTTTATGGCGGTTTGGATATTTTTAATCGAATGTGGAACATTTCAAAAGTATAA
rJMFF023N22+ ACCAAACTTTATGGCGGTTTGGATATTTTTAATCGAATGTGGAACATTTCAAAAGTATAA
                      ____________________________________________________________
consensus ACCAAACTTTATGGCGGTTTGGATATTTTTAATCGAATGTGGAACATTTCAAAAGTATAA
 
. : . : . : . : . : . :
rJMSF014I14+ ATGTGTCAAAATTGAGAGTCAAAAATTCGGTCTGAACTTGTAACGATATTTGATGGATCA
rJMFF023N22+ ATGTGTCAAAATTGAGAGTCAAAAATTCGGTCTGAACTTGTAACGATATTTGATGGATCA
                      ____________________________________________________________
consensus ATGTGTCAAAATTGAGAGTCAAAAATTCGGTCTGAACTTGTAACGATATTTGATGGATCA
 
. : . : . : . : . : . :
rJMSF014I14+ AAGGTGAAATTAACTCTGTTCCTGAAAATACTGGTATTTG
rJMFF023N22+ AAGGTGAAATTAACTCTGTTCCTGAAAATACTGGTATTTGTGTTCCATATGAATAATAAT
                      ____________________________________________________________
consensus AAGGTGAAATTAACTCTGTTCCTGAAAATACTGGTATTTGTGTTCCATATGAATAATAAT