Previous Contig 009326:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018C17Sequence493009326 (4)gb:CACAM1_16448483e-62C.annuum mRNA for calmodulin-1.764009326 (4)sp|P29060|CHIA_TOBAC1e-70Acidic endochitinase precursor (EC 3.2.1.14).>pir|S23544|S23544 chitinase (EC 3.
JMFF023N20Sequence513009326 (4)gb:CACAM1_16448484e-62C.annuum mRNA for calmodulin-1.758009326 (4)sp|P29060|CHIA_TOBAC1e-70Acidic endochitinase precursor (EC 3.2.1.14).>pir|S23544|S23544 chitinase (EC 3.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF023N20- ATACTAAAC
JMFF018C17- ATACTAAAC
                      ____________________________________________________________
consensus ATACTAAAC
 
. : . : . : . : . : . :
JMFF023N20- GCTTCTCATTTTCACCTCTTTTTTCTGGTCTCTCTTTCTCTCTATCGCTCTCTCGCGCGC
JMFF018C17- GCTTCTCATTTTCACCTCTTTTTTCTGGTCTCTCTTTCTCTCTATCGCTCTCTCGCGCGC
                      ____________________________________________________________
consensus GCTTCTCATTTTCACCTCTTTTTTCTGGTCTCTCTTTCTCTCTATCGCTCTCTCGCGCGC
 
. : . : . : . : . : . :
JMFF023N20- CAACAATGGCGGATCAGCTCACCGACGATCAGATCTCTGAGTTCAAGGAAGCTTTCAGCC
JMFF018C17- CAACAATGGCGGATCAGCTCACCGACGATCAGATCTCTGAGTTCAAGGAAGCTTTCAGCC
                      ____________________________________________________________
consensus CAACAATGGCGGATCAGCTCACCGACGATCAGATCTCTGAGTTCAAGGAAGCTTTCAGCC
 
. : . : . : . : . : . :
JMFF023N20- TGTTTGACAAGGACGGAGATGGTTGCATTACTACCAAGGAGCTGGGAACAGTTATGCGGT
JMFF018C17- TGTTTGACAAGGACGGAGATGGTTGCATTACTACCAAGGAGCTGGGAACAGTTATGCGGT
                      ____________________________________________________________
consensus TGTTTGACAAGGACGGAGATGGTTGCATTACTACCAAGGAGCTGGGAACAGTTATGCGGT
 
. : . : . : . : . : . :
JMFF023N20- CATTGGGGCAGAACCCAACTGAGGCTGAGCTTCAGGATATGATCAATGAAGTTGATGCTG
JMFF018C17- CATTGGGGCAGAACCCAACTGAGGCTGAGCTTCAGGATATGATCAATGAAGTTGATGCTG
                      ____________________________________________________________
consensus CATTGGGGCAGAACCCAACTGAGGCTGAGCTTCAGGATATGATCAATGAAGTTGATGCTG
 
. : . : . : . : . : . :
JMFF023N20- ATGGGAATGGGACAATTGACTTTCCAGAGTTCCTTAATCTCATGGCACGTAAGATGAAGG
JMFF018C17- ATGGGAATGGGACAATTGACTTTCCAGAGTTCCTTAATCTCATGGCACGTAAGATGAAGG
                      ____________________________________________________________
consensus ATGGGAATGGGACAATTGACTTTCCAGAGTTCCTTAATCTCATGGCACGTAAGATGAAGG
 
. : . : . : . : . : . :
JMFF023N20- ACACTGATTCTGAGGAGGAGCTGAAGGAAGC-TTTCCGGGTGTTTGACAAGGACCAGAAT
JMFF018C17- ACACTGATTCTGAGGAGGAGCTGAAGGAAGC-TTTCCGGGTGTTTGACAAGGACCAGAAT
rJMFF018C17+ GAGGAGGAGCTGAAGGAAGCTTTTCCGGGTGTTTGACAAGGACCAGAAT
rJMFF023N20+ TGAAGGAAGC-TTTCCGGGTGTTTGACAAGGACCAGAAT
                      ____________________________________________________________
consensus ACACTGATTCTGAGGAGGAGCTGAAGGAAGC-TTTCCGGGTGTTTGACAAGGACCAGAAT
 
. : . : . : . : . : . :
JMFF023N20- GGGTTTATCTCTGCTGCTGAGCTTCG-CCATGTGATGACAAACCTTGGTGAGAAGCTTAC
JMFF018C17- GGGTTTATCTCTGCTGCTGAGCTTCG-CCATGTGATGACAAACCTTGGTGAGAAGCTTAC
rJMFF018C17+ GGGTTTATCTCTGCTGCTGAGCTTCG-CCATGTGATGACAAACCTTGGTGAGAAGCTTAC
rJMFF023N20+ GGGTTTATCTCTGCTGCTGAGCTTCGCCCATGTGATGACAAACCTTGGTGAGAAGCTTAC
                      ____________________________________________________________
consensus GGGTTTATCTCTGCTGCTGAGCTTCG-CCATGTGATGACAAACCTTGGTGAGAAGCTTAC
 
. : . : . : . : . : . :
JMFF018C17- CTCTGCTGATGATGCAAAGAATGTGGCACAATATCTTTGGGACAACTTTCTTGGAGGGCA
rJMFF018C17+ CTCTGCTGATGATGCAAAGAATGTGGCACAATATCTTTGGGACAACTTTCTTGGAGGGCA
rJMFF023N20+ CTCTGCTGATGATGCAAAGAATGTGGCACAATATCTTTGGGACAACTTTCTTGGAGGGCA
                      ____________________________________________________________
consensus CTCTGCTGATGATGCAAAGAATGTGGCACAATATCTTTGGGACAACTTTCTTGGAGGGCA
 
. : . : . : . : . : . :
JMFF018C17- GTCACC
rJMFF018C17+ GTCACCGTCAAGGCCACTGGGGGATGAAAGCCTAGACGGAATCGACTTTGATATAGAGGC
rJMFF023N20+ GTCACCGTCAAGGCCACTGGGGGATGAAAGCCTAGACGGAATCGACTTTGATATAGAGGC
                      ____________________________________________________________
consensus GTCACCGTCAAGGCCACTGGGGGATGAAAGCCTAGACGGAATCGACTTTGATATAGAGGC
 
. : . : . : . : . : . :
rJMFF018C17+ TGGCGGCGGCGAATTCTACGACGAACTAGCCAAGGCCTTGTCGGAATTTGGACAAAAAGT
rJMFF023N20+ TGGCGGCGGCGAATTCTACGACGAACTAGCCAAGGCCTTGTCGGAATTTGGACAAAAAGT
                      ____________________________________________________________
consensus TGGCGGCGGCGAATTCTACGACGAACTAGCCAAGGCCTTGTCGGAATTTGGACAAAAAGT
 
. : . : . : . : . : . :
rJMFF018C17+ CTACTTGTCAGCAGCTCCACAATGTCCATTCCCCGACCAAAGGCTGCAAGGCGCCATAAA
rJMFF023N20+ CTACTTGTCAGCAGCTCCACAATGTCCATTCCCCGACCAAAGGCTGCAAGGCGCCATAAA
                      ____________________________________________________________
consensus CTACTTGTCAGCAGCTCCACAATGTCCATTCCCCGACCAAAGGCTGCAAGGCGCCATAAA
 
. : . : . : . : . : . :
rJMFF018C17+ CACCGGCCTTTTCGACTACGTCTGGGTACAGTTCTACAACAATCCTCCCTGTCAGTACTC
rJMFF023N20+ CACCGGCCTTTTCGACTACGTCTGGGTACAGTTCTACAACAATCCTCCCTGTCAGTACTC
                      ____________________________________________________________
consensus CACCGGCCTTTTCGACTACGTCTGGGTACAGTTCTACAACAATCCTCCCTGTCAGTACTC
 
. : . : . : . : . : . :
rJMFF018C17+ CGGCGACGCCACCAATCTTTTGAACTCTTGGAACAATGACTGGTCAACCATTCCCACCGG
rJMFF023N20+ CGGCGACGCCACCAATCTTTTGAACTCTTGGAACAATGACTGGTCAACCATTCCCACCGG
                      ____________________________________________________________
consensus CGGCGACGCCACCAATCTTTTGAACTCTTGGAACAATGACTGGTCAACCATTCCCACCGG
 
. : . : . : . : . : . :
rJMFF018C17+ AAAACTATTCTTGGGTTTGCCAGCGTCCCCGGAAGCAGCCGGAAGTGGTTTCATTCCGGC
rJMFF023N20+ AAAACTATTCTTGGGTTTGCCAGCGTCCCCGGAAGCAGCCGGAAGTGGTTTCATTCCGGC
                      ____________________________________________________________
consensus AAAACTATTCTTGGGTTTGCCAGCGTCCCCGGAAGCAGCCGGAAGTGGTTTCATTCCGGC
 
. : . : . : . : . : . :
rJMFF018C17+ AGATGTGCTAACTTCTCAGATTCTCCCGGCAATCACGGCCACACTCAAATACGGTGGCGT
rJMFF023N20+ AGATGTGCTAACTTCTCAGATTCTCCCGGCAATCACGGCCACACTCAAATACGGTGGCGT
                      ____________________________________________________________
consensus AGATGTGCTAACTTCTCAGATTCTCCCGGCAATCACGGCCACACTCAAATACGGTGGCGT
 
. : . : . : . : . : . :
rJMFF018C17+ AATGCTATGGTCTAAGTTCTATGACAATGGCTACAGCGCAAGCATCAAGCCAGCAGTTTG
rJMFF023N20+ AATGCTATGGTCTAAGTTCTATGACAATGGCTACAGCGCAAGCATCAAGCCAGCAGTTTG
                      ____________________________________________________________
consensus AATGCTATGGTCTAAGTTCTATGACAATGGCTACAGCGCAAGCATCAAGCCAGCAGTTTG
 
. : . : . : . : . : . :
rJMFF018C17+ ATCAGATCAAAACGTCACTACTTTTGTGACAACCTTGTACCTACTTATGATGCATGATTC
rJMFF023N20+ ATCAGATCAAAACGTCACTACTTTTGTGACAACCTTGTACCTACTTATGATGCATGATTC
                      ____________________________________________________________
consensus ATCAGATCAAAACGTCACTACTTTTGTGACAACCTTGTACCTACTTATGATGCATGATTC
 
. : . : . : . : . : . :
rJMFF018C17+ CATGAGATAACTGTGTATCATAAGCATAAATAATTCTGCAAACTTCTAATAAATCT
rJMFF023N20+ CATGAGATAACTGTGTATCATAAGCATAAATAATTCTGCAAACTTCTAATAAATCTGCAG
                      ____________________________________________________________
consensus CATGAGATAACTGTGTATCATAAGCATAAATAATTCTGCAAACTTCTAATAAATCTGCAG