Previous Contig 009318:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023K20Sequence567009318 (2)gb:AY088851_15738605e-27Arabidopsis thaliana clone 97304 mRNA, complete sequence.>gb:BT004576_1637610 Ar579009318 (2)gb:AY088851_15738605e-27Arabidopsis thaliana clone 97304 mRNA, complete sequence.>gb:BT004576_1637610 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF023K20- CATTATCCAAACTCTAGGGTCAAACCGTCATAACAATCT
rJMFF023K20+ CATTATCCAAACTCTAGGGTCAAACCGTCATAACAATCT
                      ____________________________________________________________
consensus CATTATCCAAACTCTAGGGTCAAACCGTCATAACAATCT
 
. : . : . : . : . : . :
JMFF023K20- CCAAGTGAATTTGTTACTTCGCCTTCACCTCCAAAGATCAGCGCCATCGAGGTCAAAATC
rJMFF023K20+ CCAAGTGAATTTGTTACTTCGCCTTCACCTCCAAAGATCAGCGCCATCGAGGTCAAAATC
                      ____________________________________________________________
consensus CCAAGTGAATTTGTTACTTCGCCTTCACCTCCAAAGATCAGCGCCATCGAGGTCAAAATC
 
. : . : . : . : . : . :
JMFF023K20- CGCCGGCAATTTCCACCATGGCAATGTATATCCGTGTCAAGCGCAGTAGGACAACCTACT
rJMFF023K20+ CGCCGGCAATTTCCACCATGGCAATGTATATCCGTGTCAAGCGCAGTAGGACAACCTACT
                      ____________________________________________________________
consensus CGCCGGCAATTTCCACCATGGCAATGTATATCCGTGTCAAGCGCAGTAGGACAACCTACT
 
. : . : . : . : . : . :
JMFF023K20- TTATTCAGTGTGAACCAACTGAGACAATTTTACAAATCAAGGAGAAATTGCGGGTTCTTA
rJMFF023K20+ TTATTCAGTGTGAACCAACTGAGACAATTTTACAAATCAAGGAGAAATTGCGGGTTCTTA
                      ____________________________________________________________
consensus TTATTCAGTGTGAACCAACTGAGACAATTTTACAAATCAAGGAGAAATTGCGGGTTCTTA
 
. : . : . : . : . : . :
JMFF023K20- TAGATCAACCTGTAAATGATCAGCGCCTGATTCTATTGGAAACTAGGGAGGTTTTGGATG
rJMFF023K20+ TAGATCAACCTGTAAATGATCAGCGCCTGATTCTATTGGAAACTAGGGAGGTTTTGGATG
                      ____________________________________________________________
consensus TAGATCAACCTGTAAATGATCAGCGCCTGATTCTATTGGAAACTAGGGAGGTTTTGGATG
 
. : . : . : . : . : . :
JMFF023K20- ACACAAAGTCATTGGCGGATCAGAAGGTTGAGAATGATGCTGTAGTGGCACTGACTCTGA
rJMFF023K20+ ACACAAAGTCATTGGCGGATCAGAAGGTTGAGAATGATGCTGTAGTGGCACTGACTCTGA
                      ____________________________________________________________
consensus ACACAAAGTCATTGGCGGATCAGAAGGTTGAGAATGATGCTGTAGTGGCACTGACTCTGA
 
. : . : . : . : . : . :
JMFF023K20- AACAAGATGATAATAACGATTTTGAGGACGTGAATGTGGTGAGACCGGATGATTTTTACC
rJMFF023K20+ AACAAGATGATAATAACGATTTTGAGGACGTGAATGTGGTGAGACCGGATGATTTTTACC
                      ____________________________________________________________
consensus AACAAGATGATAATAACGATTTTGAGGACGTGAATGTGGTGAGACCGGATGATTTTTACC
 
. : . : . : . : . : . :
JMFF023K20- AATCCCGCGATCCAGACAGCAGCACCAATTGGTGATTCTGGGATTTACTGGCTACTATCG
rJMFF023K20+ AATCCCGCGATCCAGACAGCAGCACCAATTGGTGATTCTGGGATTTACTGGCTACTATCG
                      ____________________________________________________________
consensus AATCCCGCGATCCAGACAGCAGCACCAATTGGTGATTCTGGGATTTACTGGCTACTATCG
 
. : . : . : . : . : . :
JMFF023K20- TTGCTTTGACATAAACATCTGTATGCTTTGTACACATTGAGTTGAAATAGAACTATAGAA
rJMFF023K20+ TTGCTTTGACATAAACATCTGTATGCTTTGTACACATTGAGTTGAAATAGAACTATAGAA
                      ____________________________________________________________
consensus TTGCTTTGACATAAACATCTGTATGCTTTGTACACATTGAGTTGAAATAGAACTATAGAA
 
. : . : . : . : . : . :
JMFF023K20- GTACTACTTTCTTTAACCCATTTGTGGATAAATTGTACTGTACCATTT
rJMFF023K20+ GTACTACTTTCTTTAACCCATTTGTGGATAAATTGTACTGTACCATTTTAAAATTTTGCC
                      ____________________________________________________________
consensus GTACTACTTTCTTTAACCCATTTGTGGATAAATTGTACTGTACCATTTTAAAATTTTGCC