Previous Contig 009311:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023I13Sequence589009311 (2)gb:AP005473_18524973e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFF027N14Sequence544014619673009311 (2)gb:AP005473_18524972e-72Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF027N14+ TGGAAGAAAAGGTCCGGC
                      ____________________________________________________________
consensus TGGAAGAAAAGGTCCGGC
 
. : . : . : . : . : . :
rJMFF027N14+ TTTAACATGGCCTCAACGACTTAAGATAGCAGTTGATGTTGCTCGTGGCTTGAATTATNT
                      ____________________________________________________________
consensus TTTAACATGGCCTCAACGACTTAAGATAGCAGTTGATGTTGCTCGTGGCTTGAATTATNT
 
. : . : . : . : . : . :
rJMFF027N14+ CCATTTTGACCGTGAGGTTCCNCATGGGAACCTCAAAGCAACCAACGTGCTGTTGGATGG
rJMFF023I13+ GTGAGGTTCCNCATGGGAACCTCAAAGCAACCAACGTGCTGTTGGATGG
                      ____________________________________________________________
consensus CCATTTTGACCGTGAGGTTCCNCATGGGAACCTCAAAGCAACCAACGTGCTGTTGGATGG
 
. : . : . : . : . : . :
rJMFF027N14+ CCCGGATTTTAATGCCCGGGTAGNTGATTNCTGCCTGCNCCGCCTCATGACCCAAGCAGG
rJMFF023I13+ CCCGGATTTTAATGCCCGGGTAGGTGATTACTGCCTGCNCCGCCTCATGACCCAAGCAGG
                      ____________________________________________________________
consensus CCCGGATTTTAATGCCCGGGTAGGTGATTACTGCCTGCNCCGCCTCATGACCCAAGCAGG
 
. : . : . : . : . : . :
rJMFF027N14+ AACGATNGAGCAGATTNTTGATGCAGGAGTGTTGGGGTATNGGGCACCAGAGCTGGCTGC
rJMFF023I13+ AACGATNGAGCAGATTTTTGATGCAGGAGTGTTGGGGTATNGGGCNCCAGAGCTGGNTGC
                      ____________________________________________________________
consensus AACGATNGAGCAGATTTTTGATGCAGGAGTGTTGGGGTATNGGGCACCAGAGCTGGCTGC
 
. : . : . : . : . : . :
rJMFF027N14+ CTNGAAGAAGCCNCTGCCCTNTTTCAAATCAGATGTATATGCTTTCGGAGTGATATTGTT
rJMFF023I13+ CTTGAAGAAGCCNCTGCCCTNTTTCAAATCAGANGTATATGCTTTNGGAGNGATATTGTT
                      ____________________________________________________________
consensus CTTGAAGAAGCCNCTGCCCTNTTTCAAATCAGATGTATATGCTTTCGGAGTGATATTGTT
 
. : . : . : . : . : . :
rJMFF027N14+ GGAGCTTTTAACTGGAAAATGTGCGGGCGATGTGGTTTTTGGAGAAGACGGTGGGGTTGA
rJMFF023I13+ GGAGNTTTTAACTGGAAAATGTGCGGGNGATGTGGTTTTTGGAGAAGACGGTGGGGTTGA
                      ____________________________________________________________
consensus GGAGCTTTTAACTGGAAAATGTGCGGGCGATGTGGTTTTTGGAGAAGACGGTGGGGTTGA
 
. : . : . : . : . : . :
rJMFF027N14+ TTTGACGGACTGGGTGAGGTTGAAGGTGGCGGAGGGTCACGGTTTTGATTGTTTTGATAC
rJMFF023I13+ TTTGACGGACTGGGTGAGGTTGAAGGTGGCGGAGGGTCNCGGTTTTGATTGTTTTGATAC
                      ____________________________________________________________
consensus TTTGACGGACTGGGTGAGGTTGAAGGTGGCGGAGGGTCACGGTTTTGATTGTTTTGATAC
 
. : . : . : . : . : . :
rJMFF027N14+ TGTGCTGTTGCCTGAGATGGGGAATCCGGTGGTGGAGAAACATATGAAGGAGGTTATGGG
rJMFF023I13+ TGTGCTGTTGCCTGAGATGGGGAATCCGGTGGTGGAGAAACATATGAAGGAGGTTATGGG
                      ____________________________________________________________
consensus TGTGCTGTTGCCTGAGATGGGGAATCCGGTGGTGGAGAAACATATGAAGGAGGTTATGGG
 
. : . : . : . : . : . :
rJMFF027N14+ AATAGCCTTAAGGTGTATACGCTCCGTATCGGAGAGGCCGGGGATCAAGACTATNTATGA
rJMFF023I13+ AATANCCTTAAGGNGTATACGCTCCGTATNGGAGAGGCCGGGGATCAAGACTATNTATGA
                      ____________________________________________________________
consensus AATAGCCTTAAGGTGTATACGCTCCGTATCGGAGAGGCCGGGGATCAAGACTATNTATGA
 
. : . : . : . : . : . :
rJMFF027N14+ GGACCTATCATNTATATAATGTGATATTTTAGCTTNTGGGAATCAAATAGCTCATTGGTA
rJMFF023I13+ GGACCTATCATNTATATAANGNGATATTTTAGCTTNTGGGAATCAAATAGCTCATTGGTA
                      ____________________________________________________________
consensus GGACCTATCATNTATATAATGTGATATTTTAGCTTNTGGGAATCAAATAGCTCATTGGTA
 
. : . : . : . : . : . :
rJMFF027N14+ TCCCTTTTTTTTTTGTTCAGTTGAAGTAGGATTGTTAGTGTGGATGAACTAATTC
rJMFF023I13+ TCCCTTTTTTTTTTGTTCAGTTGAAGTAGGATTGTTAGTGTGGATGAACTAATTCTATTA
                      ____________________________________________________________
consensus TCCCTTTTTTTTTTGTTCAGTTGAAGTAGGATTGTTAGTGTGGATGAACTAATTCTATTA