Previous Contig 009297:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023F01Sequence268006158 (2)678009297 (2)gb:AY084279_15693716e-56Arabidopsis thaliana clone 10216 mRNA, complete sequence.>gb:AF168391_1774090 Ar
JMSF033E15Sequence658009297 (2)gb:AY084279_15693717e-67Arabidopsis thaliana clone 10216 mRNA, complete sequence.>gb:AF168391_1774090 Ar755012889 (31)gb:AY389550_11781955e-89Hyacinthus orientalis ADP-ribosylation factor (ARF) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033E15+ CTCTGCACTTCCACAAGTCAT
                      ____________________________________________________________
consensus CTCTGCACTTCCACAAGTCAT
 
. : . : . : . : . : . :
JMSF033E15+ GTGGTCAACCTTCCTCCCATATGTTCCAAACACAATCTTGCCGGGTGCAATATCTTTTGT
rJMFF023F01+ GGGTGCAATATCTTTTGT
                      ____________________________________________________________
consensus GTGGTCAACCTTCCTCCCATATGTTCCAAACACAATCTTGCCGGGTGCAATATCTTTTGT
 
. : . : . : . : . : . :
JMSF033E15+ AATGGCAGTGACAGCTGTGCTTATGGCTCGCATGGGTAAACTGTCAGAGCAAGGTGTCAA
rJMFF023F01+ AATGGCAGTGACAGCTGTGCTTATGGCTCGCATGGGTAAACTGTCAGAGCAAGGTGTCAA
                      ____________________________________________________________
consensus AATGGCAGTGACAGCTGTGCTTATGGCTCGCATGGGTAAACTGTCAGAGCAAGGTGTCAA
 
. : . : . : . : . : . :
JMSF033E15+ ATTCATTGCATCACTATCTGGGTGGACTGCCACTCTTCTTTTTATGTGGATGCCAGTTGC
rJMFF023F01+ ATTCATTGCATCACTATCTGGGTGGACTGCCACTCTTCTTTTTATGTGGATGCCAGTTGC
                      ____________________________________________________________
consensus ATTCATTGCATCACTATCTGGGTGGACTGCCACTCTTCTTTTTATGTGGATGCCAGTTGC
 
. : . : . : . : . : . :
JMSF033E15+ ACAAATGTGGACAAATATTCTTAATCCTGATAACATCAAGGGTTTATCTGCTGTCTCAAT
rJMFF023F01+ ACAAATGTGGACAAATATTCTTAATCCTGATAACATCAAGGGTTTATCTGCTGTCTCAAT
                      ____________________________________________________________
consensus ACAAATGTGGACAAATATTCTTAATCCTGATAACATCAAGGGTTTATCTGCTGTCTCAAT
 
. : . : . : . : . : . :
JMSF033E15+ GTTGCTGGCCATGATTGGGAATGGACTAATGATTCCTCGAGCACTCCTTACTCGGGACTT
rJMFF023F01+ GTTGCTGGCCATGATTGGGAATGGACTAATGATTCCTCGAGCACTCCTTACTCGGGACTT
                      ____________________________________________________________
consensus GTTGCTGGCCATGATTGGGAATGGACTAATGATTCCTCGAGCACTCCTTACTCGGGACTT
 
. : . : . : . : . : . :
JMSF033E15+ CATGTGGTTCGCAGGTTCTAGTTGGGCGTGCATTTTTTATGGATGGGGAAATCTTGTTTG
rJMFF023F01+ CATGTGGTTCGCAGGTTCTAGTTGGGCGTGCATTTTTTATGGATGGGGAAATCTTGTTTG
                      ____________________________________________________________
consensus CATGTGGTTCGCAGGTTCTAGTTGGGCGTGCATTTTTTATGGATGGGGAAATCTTGTTTG
 
. : . : . : . : . : . :
JMSF033E15+ CTTGTATAGTTTAAAAGTCATTAGCAAGGAATTTTTCTTGTCTGCTACAGTTGCGTTTGT
rJMFF023F01+ CTTGTATAGTTTAAAAGTCATTAGCAAGGAATTTTTCTTGTCTGCTACAGTTGCGTTTGT
                      ____________________________________________________________
consensus CTTGTATAGTTTAAAAGTCATTAGCAAGGAATTTTTCTTGTCTGCTACAGTTGCGTTTGT
 
. : . : . : . : . : . :
JMSF033E15+ AGCATGGATAGTTATGGCCTTCTGGAAAGATATGCAAGTATATGGTTACAGGTCACCCTT
rJMFF023F01+ AGCATGGATAGTTATGGCCTTCTGGAAAGATATGCAAGTATATGGTTACAGGTCACCCTT
                      ____________________________________________________________
consensus AGCATGGATAGTTATGGCCTTCTGGAAAGATATGCAAGTATATGGTTACAGGTCACCCTT
 
. : . : . : . : . : . :
JMSF033E15+ GACATCCTTGAAGAATTTGGTTTCTGGTTCAAAATAGCGACCCTTTGAAGAATTTGGTTT
rJMFF023F01+ GACATCCTTGAAGAATTTGGTTTCTGGTTCAAAATAGCGACCCTTTGAAGAATTTGGTTT
                      ____________________________________________________________
consensus GACATCCTTGAAGAATTTGGTTTCTGGTTCAAAATAGCGACCCTTTGAAGAATTTGGTTT
 
. : . : . : . : . : . :
JMSF033E15+ CTAGTTCAAAATAACTGGTGCGACAGCTTCTTCCAGGCCGCTGTGGCTCCAAGAACAGAA
rJMFF023F01+ CTAGTTCAAAATAACTGGTGCGACAGCTTCTTCCAGGCCGCTGTGGCTCCAAGAACAGAA
                      ____________________________________________________________
consensus CTAGTTCAAAATAACTGGTGCGACAGCTTCTTCCAGGCCGCTGTGGCTCCAAGAACAGAA
 
. : . : . : . : . : . :
JMSF033E15+ TGCCAGTATGATATTGCTTCAGTTTTGGCAGTTTATT
rJMFF023F01+ TGCCAGTATGATATTGCTTCAGTTTTGGCAGTTTATTCTCGAGGAAATAGTCAGTTTTGC
                      ____________________________________________________________
consensus TGCCAGTATGATATTGCTTCAGTTTTGGCAGTTTATTCTCGAGGAAATAGTCAGTTTTGC
 
. : . : . : . : . : . :
rJMFF023F01+ GAGAACCTATTTTAGCATTGGCCCAAAGTTTCATTTCGCTTTGCTATGTACAGTACATAT
                      ____________________________________________________________
consensus GAGAACCTATTTTAGCATTGGCCCAAAGTTTCATTTCGCTTTGCTATGTACAGTACATAT