Previous Contig 009294:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023D23Sequence462001138 (2)gb:AY059854_15646981e-10Arabidopsis thaliana serine carboxypeptidase II, putative (At1g28110; F13K9.20) 729009294 (2)gb:AY059854_15646983e-57Arabidopsis thaliana serine carboxypeptidase II, putative (At1g28110; F13K9.20)
JMSF036H23Sequence678001138 (2)gb:AY059854_15646981e-52Arabidopsis thaliana serine carboxypeptidase II, putative (At1g28110; F13K9.20) 558009294 (2)gb:AY059854_15646982e-40Arabidopsis thaliana serine carboxypeptidase II, putative (At1g28110; F13K9.20)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023D23+ TTCCAGCAA
                      ____________________________________________________________
consensus TTCCAGCAA
 
. : . : . : . : . : . :
rJMFF023D23+ GCAGAGACTNTTAATCAGNGGCAAGAAACAGAGAAGATAGATGTGTGTGTGGAGGATGAA
                      ____________________________________________________________
consensus GCAGAGACTNTTAATCAGNGGCAAGAAACAGAGAAGATAGATGTGTGTGTGGAGGATGAA
 
. : . : . : . : . : . :
rJMFF023D23+ ACCATAGAGTATTTGAACAGGAAAGATGTGCAGATAGCTCTCCATGCTCAGCTTCTTGGA
                      ____________________________________________________________
consensus ACCATAGAGTATTTGAACAGGAAAGATGTGCAGATAGCTCTCCATGCTCAGCTTCTTGGA
 
. : . : . : . : . : . :
rJMSF036H23+ AGTCCTGCAGTATGACATGCAGAACCTGGAGGTT
rJMFF023D23+ GTGAAGAGATGGAGTTCGTGCAGCGAAGTCCTGCAGTATGACATGCAGAACCTGGAGGTT
                      ____________________________________________________________
consensus GTGAAGAGATGGAGTTCGTGCAGCGAAGTCCTGCAGTATGACATGCAGAACCTGGAGGTT
 
. : . : . : . : . : . :
rJMSF036H23+ CCAACCATTCCAATTTTAGGCTCACTTGTCAAGTCTGGAATTCGCGTATTGGTTTTCAGC
rJMFF023D23+ CCAACCATTCCAATTTTAGGCTCACTTGTCAAGTCTGGAATTCGCGTATTGGTTTTCAGC
                      ____________________________________________________________
consensus CCAACCATTCCAATTTTAGGCTCACTTGTCAAGTCTGGAATTCGCGTATTGGTTTTCAGC
 
. : . : . : . : . : . :
rJMSF036H23+ GGAGATCAAGATTCGGTTATACCTTTTACTGGAACCCGAACGCTTGTAAACAAATTGGCA
rJMFF023D23+ GGAGATCAAGATTCGGTTATACCTTTTACTGGAACCCGAACGCTTGTAAACAAATTGGCA
                      ____________________________________________________________
consensus GGAGATCAAGATTCGGTTATACCTTTTACTGGAACCCGAACGCTTGTAAACAAATTGGCA
 
. : . : . : . : . : . :
rJMSF036H23+ CAAGATCTGGGATTGAGCACCACTGTGCCATATGGAACTTGGTTCGAGGGCAAACAGGTT
rJMFF023D23+ CAAGATCTGGGATTGAGCACCACTGTGCCATATGGAACTTGGTTCGAGGGCAAACAGGTT
                      ____________________________________________________________
consensus CAAGATCTGGGATTGAGCACCACTGTGCCATATGGAACTTGGTTCGAGGGCAAACAGGTT
 
. : . : . : . : . : . :
rJMSF036H23+ GCTGGATGGACACAAGGGTATGGAGAGCTTCTTTCATTTGCAACAATAAGGGGTGCTGCT
rJMFF023D23+ GCTGGATGGACACAAGGGTATGGAGAGCTTCTTTCATTTGCAACAATAAGGGGTGCTGCT
                      ____________________________________________________________
consensus GCTGGATGGACACAAGGGTATGGAGAGCTTCTTTCATTTGCAACAATAAGGGGTGCTGCT
 
. : . : . : . : . : . :
rJMSF036H23+ CATGAAGCTCCATTTACACAGCCTGAGAGGTCACTTGTAATGTTGAGTTCATTCTTAGCA
rJMFF023D23+ CATGAAGCTCCATTTACACAGCCTGAGAGGTCACTTGTAATGTTGAGTTCATTCTTAGCA
                      ____________________________________________________________
consensus CATGAAGCTCCATTTACACAGCCTGAGAGGTCACTTGTAATGTTGAGTTCATTCTTAGCA
 
. : . : . : . : . : . :
rJMSF036H23+ GGAAAACCACTTCCCATGCTAGATGGAAAGATGACAGGAAAAAGAAACTCACCAGCAAGA
rJMFF023D23+ GGAAAACCACTTCCCATGCTAGATGGAAAGATGACAGGAAAAAGAAACTCACCAGCAAGA
                      ____________________________________________________________
consensus GGAAAACCACTTCCCATGCTAGATGGAAAGATGACAGGAAAAAGAAACTCACCAGCAAGA
 
. : . : . : . : . : . :
rJMSF036H23+ ATATTTGCATCTCTGGGCTATCAGTAATGCAGATATGGGATGGTGAAACCACCCATGGTG
rJMFF023D23+ ATATTTGCATCTCTGGGCTATCAGTAATGCAGATATGGGATGGTGAAACCACCCATGGTG
                      ____________________________________________________________
consensus ATATTTGCATCTCTGGGCTATCAGTAATGCAGATATGGGATGGTGAAACCACCCATGGTG
 
. : . : . : . : . : . :
rJMSF036H23+ CAATATTTCTACATTAGATTTCAGAAATTTAAGGCTTAAAAGGATAGCCTATGTCTGTAT
rJMFF023D23+ CAATATTTCTACATTAGATTTCAGAAATTTAAGGCTTAAAAGGATAGCCTATGTCTGTAT
                      ____________________________________________________________
consensus CAATATTTCTACATTAGATTTCAGAAATTTAAGGCTTAAAAGGATAGCCTATGTCTGTAT
 
. : . : . : . : . : . :
rJMSF036H23+ AATGCTGATCAAATTAAAGCATATTGAAACAG
rJMFF023D23+ AATGCTGATCAAATTAAAGCATATTGAAACAGTAAAATAAAAGATTACAATAAAGAAGAA
                      ____________________________________________________________
consensus AATGCTGATCAAATTAAAGCATATTGAAACAGTAAAATAAAAGATTACAATAAAGAAGAA