Previous Contig 009289:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023D03Sequence473006975 (5)712009289 (6)gb:AY099545_15765713e-60Arabidopsis thaliana putative membrane transporter (At2g27810) mRNA, complete cd
JMFF034N03Sequence504006975 (5)gb:AY099545_15765710.005Arabidopsis thaliana putative membrane transporter (At2g27810) mRNA, complete cd748009289 (6)gb:AY099545_15765712e-72Arabidopsis thaliana putative membrane transporter (At2g27810) mRNA, complete cd
JMFS039D08Sequence614009289 (6)gb:AY099545_15765713e-96Arabidopsis thaliana putative membrane transporter (At2g27810) mRNA, complete cd
JMSF016G11Sequence486006975 (5)764009289 (6)gb:AY099545_15765711e-73Arabidopsis thaliana putative membrane transporter (At2g27810) mRNA, complete cd
JMSF016L07Sequence471006975 (5)789009289 (6)gb:AY099545_15765712e-78Arabidopsis thaliana putative membrane transporter (At2g27810) mRNA, complete cd
JMSF034M24Sequence653006975 (5)gb:AY099545_15765712e-07Arabidopsis thaliana putative membrane transporter (At2g27810) mRNA, complete cd607009289 (6)gb:AY099545_15765714e-61Arabidopsis thaliana putative membrane transporter (At2g27810) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS039D08- CAGGAACTGGGTCTACAACTTTAACTGAGAA
                      ____________________________________________________________
consensus CAGGAACTGGGTCTACAACTTTAACTGAGAA
 
. : . : . : . : . : . :
JMFS039D08- TGTGCACACCATTGCTGTCACTAAGATGGGAAGCCGCAGAGCAGTTTCACTGGGAGCAGT
                      ____________________________________________________________
consensus TGTGCACACCATTGCTGTCACTAAGATGGGAAGCCGCAGAGCAGTTTCACTGGGAGCAGT
 
. : . : . : . : . : . :
JMFS039D08- TGTTTTAATTGTTCTATCCCTTGTAGGCAAAGTAGGGGGATTTATTGCTTCAATTCCACA
rJMSF016L07+ CAAAGTAGGGGGATTTATTGCTTCAATTCCACA
rJMFF034N03+ CACA
rJMSF016G11+ CACA
                      ____________________________________________________________
consensus TGTTTTAATTGTTCTATCCCTTGTAGGCAAAGTAGGGGGATTTATTGCTTCAATTCCACA
 
. : . : . : . : . : . :
JMFS039D08- AGTCATAGTTGCAGCTCTACTATGCTTTATGTGGGCGATGCTTACGGCATTGGGCTTGTC
rJMSF016L07+ AGTCATAGTTGCAGCTCTACTATGCTTTATGTGGGCGATGCTTACGGCATTGGGCTTGTC
rJMFF034N03+ AGTCATAGTTGCAGCTNTACTATGCTTTATGTGGGCGATGCTTACGGCATTGGGCTTGTC
rJMSF016G11+ AGTCATAGTTGCAGCTCTACTATGCTTTATGTGGGCGATGCTTACGGCATTGGGCTTGTC
                      ____________________________________________________________
consensus AGTCATAGTTGCAGCTCTACTATGCTTTATGTGGGCGATGCTTACGGCATTGGGCTTGTC
 
. : . : . : . : . : . :
JMFS039D08- AAATTTACGCTACAGTGAGGCAGGAAGCTCAAGAAACATTATCATTGTTGGATTATCATT
rJMSF016L07+ AAATTTACGCTACAGTGAGGCAGGAAGCTCAAGAAACATTATCATTGTTGGATTATCATT
rJMSF034M24+ CGCTACAGTGAGGCAGGAAGCTCAAGAAACATTATCATTGTTGGATTATCATT
rJMFF034N03+ AAATTTACGCTACAGTGAGGCAGGAAGCTCAAGAAACATTATCATTGTTGGATTATCATT
rJMSF016G11+ AAATTTACGCTACAGTGAGGCAGGAAGCTCAAGAAACATTATCATTGTTGGATTATCATT
rJMFF023D03+ GCTACAGTGAGGCAGGAAGCTCAAGAAACATTATCATTGTTGGATTATCATT
                      ____________________________________________________________
consensus AAATTTACGCTACAGTGAGGCAGGAAGCTCAAGAAACATTATCATTGTTGGATTATCATT
 
. : . : . : . : . : . :
JMFS039D08- GTTTTTTTCCCTGTCAGTACCCGCCTACTTCCAACAGTATGGTATCTCTCCGAACAGTAA
rJMSF016L07+ GTTTTTTTCCCTGTCAGTACCCGCCTACTTCCAACAGTATGGTATCTCTCCGAACAGTAA
rJMSF034M24+ GTTTTTTTCCCTGTCAGTACCCGCCTACTTCCAACAGTATGGTATCTCTCCGAACAGTAA
rJMFF034N03+ GTTTTTTTCCCTGTCAGTACCCGCCTACTTCCAACAGTATGGTATCTCTCCGAACAGTAA
rJMSF016G11+ GTTTTTTTCCCTGTCAGTACCCGCCTACTTCCAACAGTATGGTATCTCTCCGAACAGTAA
rJMFF023D03+ GTTTTTTTCCCTGTCAGTACCCGCCTACTTCCAACAGTATGGTATCTCTCCGAACAGTAA
                      ____________________________________________________________
consensus GTTTTTTTCCCTGTCAGTACCCGCCTACTTCCAACAGTATGGTATCTCTCCGAACAGTAA
 
. : . : . : . : . : . :
JMFS039D08- TCTGTCTGTTCCTAGTTATTTTCAGCCCTACATTGTTGCTTCTCATGGTCCCATCCGCAC
rJMSF016L07+ TCTGTCTGTTCCTAGTTATTTTCAGCCCTACATTGTTGCTTCTCATGGTCCCATCCGCAC
rJMSF034M24+ TCTGTCTGTTCCTAGTTATTTTCAGCCCTACATTGTTGCTTCTCATGGTCCCATCCGCAC
rJMFF034N03+ TCTGTCTGTTCCTAGTTATTTTCAGCCCTACATTGTTGCTTCTCATGGTCCCATCCGCAC
rJMSF016G11+ TCTGTCTGTTCCTAGTTATTTTCAGCCCTACATTGTTGCTTCTCATGGTCCCATCCGCAC
rJMFF023D03+ TCTGTCTGTTCCTAGTTATTTTCAGCCCTACATTGTTGCTTCTCATGGTCCCATCCGCAC
                      ____________________________________________________________
consensus TCTGTCTGTTCCTAGTTATTTTCAGCCCTACATTGTTGCTTCTCATGGTCCCATCCGCAC
 
. : . : . : . : . : . :
JMFS039D08- CAAGTATGGAGGGCTAAACTATATCTTGAACACGCTTTTTTCACTGCACATGGTGATTGC
rJMSF016L07+ CAAGTATGGAGGGCTAAACTATATCTTGAACACGCTTTTTTCACTGCACATGGTGATTGC
rJMSF034M24+ CGAGTATGGAGGGCTAAACTATATCTTGAACACGCTTTTTTCACTGCACATGGTGATTGC
rJMFF034N03+ CAAGTATGGAGGGCTAAACTATATCTTGAACACGCTTTTTTCACTGCACATGGTGATTGC
rJMSF016G11+ CAAGTATGGAGGGCTAAACTATATCTTGAACACGCTTTTTTCACTGCACATGGTGATTGC
rJMFF023D03+ CAAGTATGGAGGGCTAAACTATATCTTGAACACGCTTTTTTCACTGCACATGGTGATTGC
                      ____________________________________________________________
consensus CAAGTATGGAGGGCTAAACTATATCTTGAACACGCTTTTTTCACTGCACATGGTGATTGC
 
. : . : . : . : . : . :
JMFS039D08- TTTTCTGGTAGCTGTGATCCTGGACAACACCGTGCCAGGCAGCACCCAGGAACGAGGGGT
rJMSF016L07+ TTTTCTGGTAGCTGTGATCCTGGACAACACCGTGCCAGGCAGCACCCAGGAACGAGGGGT
rJMSF034M24+ TTTTCTGGTAGCTGTGATCCTGGACAACACCGTGCCAGGCAGCACCCAGGAACGAGGGGT
rJMFF034N03+ TTTTCTGGTAGCTGTGATCCTGGACAACACCGTGCCAGGCAGCACCCAGGAACGAGGGGT
rJMSF016G11+ TTTTCTGGTAGCTGTGATCCTGGACAACACCGTGCCAGGCAGCACCCAGGAACGAGGGGT
rJMFF023D03+ TTTTCTGGTAGCTGTGATCCTGGACAACACCGTGCCAGGCAGCACCCAGGAACGAGGGGT
                      ____________________________________________________________
consensus TTTTCTGGTAGCTGTGATCCTGGACAACACCGTGCCAGGCAGCACCCAGGAACGAGGGGT
 
. : . : . : . : . : . :
JMFS039D08- GTACATGTGGTCTGAACGCGATGCTGCCAGAAGGGAACCCGCTGTAACTAAAGACTACGA
rJMSF016L07+ GTACATGTGGTCTGAACGCGATGCTGCCAGAAGGGAACCCGCTGTAACTAAAGACTACGA
rJMSF034M24+ GTACATGTGGTCTGAACGCGATGCTGCCAGAAGGGAACCCGCTGTAACTAAAGACTACGA
rJMFF034N03+ GTACATGTGGTCTGAACGCGATGCTGCCAGAAGGGAACCCGCTGTAACTAAAGACTACGA
rJMSF016G11+ GTACATGTGGTCTGAACGCGATGCTGCCAGAAGGGAACCCGCTGTAACTAAAGACTACGA
rJMFF023D03+ GTACATGTGGTCTGAACGCGATGCTGCCAGAAGGGAACCCGCTGTAACTAAAGACTACGA
                      ____________________________________________________________
consensus GTACATGTGGTCTGAACGCGATGCTGCCAGAAGGGAACCCGCTGTAACTAAAGACTACGA
 
. : . : . : . : . : . :
JMFS039D08- ATTGCCATTTAGAGTCGGGAGAGTATTCAGATGGGTAAAATGG
rJMSF016L07+ ATTGCCATTTAGAGTCGGGAGAGTATTCAGATGGGTAAAATGGGTGGGGCTTTAGCACTC
rJMSF034M24+ ATTGCCATTTAGAGTCGGGAGAGTATTCAGATGGGTAAAATGGGTGGGGCTTTAGCACTC
rJMFF034N03+ ATTGCCATTTAGAGTCGGGAGAGTATTCAGATGGGTAAAATGGGTGGGGCTTTAGCACTC
rJMSF016G11+ ATTGCCATTTAGAGTCGGGAGAGTATTCAGATGGGTAAAATGGGTGGGGCTTTAGCACTC
rJMFF023D03+ ATTGCCATTTAGAGTCGGGAGAGTATTCAGATGGGTAAAATGGGTGGGGCTTTAGCACTC
                      ____________________________________________________________
consensus ATTGCCATTTAGAGTCGGGAGAGTATTCAGATGGGTAAAATGGGTGGGGCTTTAGCACTC
 
. : . : . : . : . : . :
rJMSF016L07+ TCCGACTCGTAGCCTGCCCTGATTACCATTTTTCAAGCTCATTCCAGGCGTCTATCCCTT
rJMSF034M24+ TCCGACTCGTAGCCTGCCCTGATTACCATTTTTCAAGCTCATTCCAGGCGTCTATCCCTT
rJMFF034N03+ TCCGACTCGTAGCCTGCCCTGATTACCATTTTTCAAGCTCATTCCAGGCGTCTATCCCTT
rJMSF016G11+ TCCGACTCGTAGCCTGCCCTGATTACCATTTTTCAAGCTCATTCCAGGCGTCTATCCCTT
rJMFF023D03+ TCCGACTCGTAGCCTGCCCTGATTACCATTTTTCAAGCTCATTCCAGGCGTCTATCCCTT
                      ____________________________________________________________
consensus TCCGACTCGTAGCCTGCCCTGATTACCATTTTTCAAGCTCATTCCAGGCGTCTATCCCTT
 
. : . : . : . : . : . :
rJMSF016L07+ AATGGAATGAGTTTGGCATCTGCAGTGCCATTTTCACCGGATGCCGCTTCTTGGGAGTGT
rJMSF034M24+ AATGGAATGAGTTTGGCATCTGCAGTGCCATTTTCACCGGATGCCGCTTCTTGGGAGTGT
rJMFF034N03+ AATGGAATGAGTTTGGCATCTGCAGTGCCATTTTCACCGGATGCCGCTTCTTGGGAGTGT
rJMSF016G11+ AATGGAATGAGTTTGGCATCTGCAGTGCCATTTTCACCGGATGCCGCTTCTTGGGAGTGT
rJMFF023D03+ AATGGAATGAGTTTGGCATCTGCAGTGCCATTTTCACCGGATGCCGCTTCTTGGGAGTGT
                      ____________________________________________________________
consensus AATGGAATGAGTTTGGCATCTGCAGTGCCATTTTCACCGGATGCCGCTTCTTGGGAGTGT
 
. : . : . : . : . : . :
rJMSF016L07+ AGGCGCCCGCCTTATAGAGGTAATCTGTGTGTATATTGGAGGATCCGGGGAATGTGTTGT
rJMSF034M24+ AGGCGCCCGCCTTATAGAGGTAATCTGTGTGTATATTGGAGGATCCGGGGAATGTGTTGT
rJMFF034N03+ AGGCGCCCGCCTTATAGAGGTAATCTGTGTGTATATTGGAGGATCCGGGGAATGTGTTGT
rJMSF016G11+ AGGCGCCCGCCTTATAGAGGTAATCTGTGTGTATATTGGAGGATCCGGGGAATGTGTTGT
rJMFF023D03+ AGGCGCCCGCCTTATAGAGGTAATCTGTGTGTATATTGGAGGATCCGGGGAATGTGTTGT
                      ____________________________________________________________
consensus AGGCGCCCGCCTTATAGAGGTAATCTGTGTGTATATTGGAGGATCCGGGGAATGTGTTGT
 
. : . : . : . : . : . :
rJMSF016L07+ AATGGATATAATATTGTATGTATTTTTTTGAAGCTGAAAGATGTCCTGATGGACTTTTGC
rJMSF034M24+ AATGGATATAATAT
rJMFF034N03+ AATGGATATAATATTGTATGTATTTTTTTGAAGCTGAAAGATGTCCTGATGGACTTTTGC
rJMSF016G11+ AATGGATATAATATTGTATGTATTTTTTTGAAGCTGAAAGATGTCCTGATGGACTTTTGC
rJMFF023D03+ AATGGATATAATATTGTATGTATTTTTTTGAAGCTGAAAGATGTCCTGATGGACTTTTGC
                      ____________________________________________________________
consensus AATGGATATAATATTGTATGTATTTTTTTGAAGCTGAAAGATGTCCTGATGGACTTTTGC
 
. : . : . : . : . : . :
rJMSF016L07+ TATTCATCTGTTCTGCTGCACAGCTGCTTTTTGATC
rJMFF034N03+ TATTCATCTGTTCTGCTGCACAGC
rJMSF016G11+ TATTCATCTGTTCTGCTGCACAGCTGCTTTTTGATC
rJMFF023D03+ TATTCATCTGTTCTGCTGCACAGCTGCTTTTTGATCAATTGAATTTTCAATGCTATATAT
                      ____________________________________________________________
consensus TATTCATCTGTTCTGCTGCACAGCTGCTTTTTGATCAATTGAATTTTCAATGCTATATAT