Previous Contig 009288:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023C18Sequence453009288 (4)130009288 (4)
JMFF051N19Sequence535009288 (4)508009288 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF023C18- GCGTTTGCGCGTGCACAGTCCTGTGCGAAGCTCGTCT
JMFF051N19- GAAGCTCGTCT
                      ____________________________________________________________
consensus GCGTTTGCGCGTGCACAGTCCTGTGCGAAGCTCGTCT
 
. : . : . : . : . : . :
JMFF023C18- CAGAGGCCGGGACTGCGATGACTCGTTCAAGTGACTGGCGTCGGATGGGGAGGGGAAGGT
rJMFF051N19+ ACTGCGATGACTCGTTCAAGTGATTGGCGTCGGATGGGGAGGGGAAGGT
JMFF051N19- CAGAGGCCGGGACTGCGATGACTCGTTCAAGTGACTGGCGTCGGATGGGGAGGGGAAGGT
                      ____________________________________________________________
consensus CAGAGGCCGGGACTGCGATGACTCGTTCAAGTGACTGGCGTCGGATGGGGAGGGGAAGGT
 
. : . : . : . : . : . :
JMFF023C18- CGGGGCAGCCGTTGTCGCCTGCGACTCTGCCATCGTCCGGGTCGCACAGGGAGGCCGAGG
rJMFF051N19+ CGGGGCAGCCGTTGTCGCCTGCGACTCTGCCATCGTCCGGGTCGCACAGGGAGGCCGAGG
JMFF051N19- CGGGGCAGCCGTTGTCGCCTGCGACTCTGCCATCGTCCGGGTCGCACAGGGAGGCCGAGG
                      ____________________________________________________________
consensus CGGGGCAGCCGTTGTCGCCTGCGACTCTGCCATCGTCCGGGTCGCACAGGGAGGCCGAGG
 
. : . : . : . : . : . :
JMFF023C18- GTTCCCGACCGTTCAAACGTCGCTCCGGTCAGCACACGGCGCATTCGACAGCGGCAGGGG
rJMFF051N19+ GTTCCCGACCGTTCAAACGTCGCTCCGGTCAGCACACGGCGCATTCGACAGCGGCAGGGG
JMFF051N19- GTTCCCGACCGTTCAAACGTCGCTCCGGTCAGCACACGGCGCATTCGACAGCGGCAGGGG
                      ____________________________________________________________
consensus GTTCCCGACCGTTCAAACGTCGCTCCGGTCAGCACACGGCGCATTCGACAGCGGCAGGGG
 
. : . : . : . : . : . :
JMFF023C18- ATTTCGACCAGGCTACGGTCAGGATAGCGTCCAGGGTTGCTGCAAGGCGGCAGGCGGTGC
rJMFF051N19+ ATTTCGACCAGGCTACGGTCAGGATAGCGTCCAGGGTTGCTGCAAGGCGGCAGGCGGTGC
JMFF051N19- ATTTCGACCAGGCTACGGTCAGGATAGCGTCCAGGGTTGCTGCAAGGCGGCAGGCGGTGC
                      ____________________________________________________________
consensus ATTTCGACCAGGCTACGGTCAGGATAGCGTCCAGGGTTGCTGCAAGGCGGCAGGCGGTGC
 
. : . : . : . : . : . :
JMFF023C18- ACCGGGGGGTCAGACAGTGTTGCATTGAGCGTCGTCATGTGTTGTCGCTTGACGTTGCAA
rJMFF051N19+ ACCGGGGGGTCAGACAGTGTTGCATTGAGCGTCGTCATGTGTTGTCGCTTGACGTTGCAA
JMFF051N19- ACCGGGGGGTCAGACAGTGTTGCATTGAGCGTCGTCATGTGTTGTCGCTTGACGTTGCAA
                      ____________________________________________________________
consensus ACCGGGGGGTCAGACAGTGTTGCATTGAGCGTCGTCATGTGTTGTCGCTTGACGTTGCAA
 
. : . : . : . : . : . :
JMFF023C18- GGACCGTCGTTTAGTGCCACGGTGTGATTCGTTGTGCGCGGTAAGTGGTGTGCCTGAGAG
rJMFF051N19+ GGACCGTCGTTTAGTGCCACGGTGTGATTCGTTGTGCGCGGTAAGTGGTGTGCCTGAGAG
JMFF051N19- GGACCGTCGTTTAGTGCCACGGTGTGATTCGTTGTGCGCGGTAAGTGGTGTGCCTGAGAG
                      ____________________________________________________________
consensus GGACCGTCGTTTAGTGCCACGGTGTGATTCGTTGTGCGCGGTAAGTGGTGTGCCTGAGAG
 
. : . : . : . : . : . :
JMFF023C18- TGCTCTAGAATATTCGTTGAGCGTCATCATGTGTTGTCGCTTGACATTGCGTTATC
rJMFF051N19+ TGCTCTAGAATATTCGTTGAGCGTCATCATGTGTTGTCGCTTGACATTGCGTTATCCACG
JMFF051N19- TGCTCTAGAATATTCGTTGAGCGTCATCATGTGTTGTCGCTTGACATTGCGTTATCCACG
rJMFF023C18+ GTTATCCACG
                      ____________________________________________________________
consensus TGCTCTAGAATATTCGTTGAGCGTCATCATGTGTTGTCGCTTGACATTGCGTTATCCACG
 
. : . : . : . : . : . :
rJMFF051N19+ TCTGGTTTTTGAATATTTATGA-CGCCGTTCTTGTAAATAATCTTGGCCAACATTAAATT
JMFF051N19- TCTGGTTTTTGAATATTTATGA-CGCCGTTCTTGTANATAATCTTGGCCAACATTAAATT
rJMFF023C18+ TATGGTTTTNGAATATTTATGANAGCCGTTCTTGTAAATAATCTTGNCCAACATTAAATT
                      ____________________________________________________________
consensus TCTGGTTTTTGAATATTTATGA-CGCCGTTCTTGTAAATAATCTTGGCCAACATTAAATT
 
. : . : . : . : . : . :
rJMFF051N19+ GTCAGTTTCATATAAAGCATCATCATCATTATTGTTGGG
JMFF051N19- GTCAGTTTCATATAAAGCATCATCATCATTATTGTTGGG
rJMFF023C18+ GTCAGTTTCATATAAAGCATCATCATCATTATTGTTGGGTGAATTACTTAAATTGTCATT
                      ____________________________________________________________
consensus GTCAGTTTCATATAAAGCATCATCATCATTATTGTTGGGTGAATTACTTAAATTGTCATT