Previous Contig 009287:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023C10Sequence465009287 (4)716009287 (4)
JMFF047I22Sequence391009287 (4)389009287 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF047I22+ CCCATACACAAAAACCCTCAACT
JMFF047I22- CCCATACACAAAAACCCTCAACT
JMFF023C10- GTCACCACCCATACACAAAAACCCTCAACT
                      ____________________________________________________________
consensus GTCACCACCCATACACAAAAACCCTCAACT
 
. : . : . : . : . : . :
rJMFF047I22+ ATCACCATAGAAGCTAAACAAGAAA-CCTTGTCACACAACCTAGGATTTGCCACTCTTGG
JMFF047I22- ATCACCATAGAAGCTAAACAAGAAA-CCTTGTCACACAACCTAGGATTTGCCACTCTTGG
JMFF023C10- ATCACCATAGAAGCTAAACAAGAAA-CCTTGTCACACAACCTAGGATTTGCCACTCTTGG
rJMFF023C10+ ACCATAGAAGCTAACCAAGAAACCCTTGTCACACAACCTAGGATTTGCCACTCTTGG
                      ____________________________________________________________
consensus ATCACCATAGAAGCTAAACAAGAAA-CCTTGTCACACAACCTAGGATTTGCCACTCTTGG
 
. : . : . : . : . : . :
rJMFF047I22+ TGAGCTTCCTAGCATGGCTAAATTCGCGGCGTCAGCTCTAGTTGCTTTGCTTGTATTTTC
JMFF047I22- TGAGCTTCCTAGCATGGCTAAATTCGCGGCGTCAGCTCTAGTTGCTTTGCTTGTATTTTC
JMFF023C10- TGAGCTTCCTAGCATGGCTAAATTCGCGGCGTCAGCTCTAGTTGCTTTGCTTGTATTTTC
rJMFF023C10+ TGAGCTTCCTAGCATGGCTAAATTCGCGGCGTCAGCTCTAGTTGCTTTGCTTGTATTTTC
                      ____________________________________________________________
consensus TGAGCTTCCTAGCATGGCTAAATTCGCGGCGTCAGCTCTAGTTGCTTTGCTTGTATTTTC
 
. : . : . : . : . : . :
rJMFF047I22+ TAGTGTGTTTGTGGTGTCCCAGAGTCGGGACATCAAGGCCGAAAAGGCGGCCCAAGTAAG
JMFF047I22- TAGTGTGTTTGTGGTGTCCCAGAGTCGGGACATCAAGGCCGAAAAGGCGGCCCAAGTAAG
JMFF023C10- TAGTGTGTTTGTGGTGTCCCAGAGTCGGGACATCAAGGCCGAAAAGGCGGCCCAAGTAAG
rJMFF023C10+ TAGTGTGTTTGTGGTGTCCCAGAGTCGGGACATCAAGGCCGAAAAGGCGGCCCAAGTAAG
                      ____________________________________________________________
consensus TAGTGTGTTTGTGGTGTCCCAGAGTCGGGACATCAAGGCCGAAAAGGCGGCCCAAGTAAG
 
. : . : . : . : . : . :
rJMFF047I22+ GACGGAGGGGTTAGGGTTGGACCTGGGTGGTATTGGCATCGGTATTGGTGCGGGCATTGG
JMFF047I22- GACGGAGGGGTTAGGGTTGGACCTGGGTGGTATTGGCATCGGTATTGGTGCGGGCATTGG
JMFF023C10- GACGGAGGGGTTAGGGTTGGACCTGGGTGGTATTGGCATCGGTATTGGTGCGGGCATTGG
rJMFF023C10+ GACGGAGGGGTTAGGGTTGGACCTGGGTGGTATTGGCATCGGTATTGGTGCGGGCATTGG
                      ____________________________________________________________
consensus GACGGAGGGGTTAGGGTTGGACCTGGGTGGTATTGGCATCGGTATTGGTGCGGGCATTGG
 
. : . : . : . : . : . :
rJMFF047I22+ TATTGGATTAGGTGGTAGCGGTAGTGGGTCAGGGGCAGGAGCAGGTTCGGGTTCAGGCGG
JMFF047I22- TATTGGATTAGGTGGTAGCGGTAGTGGGTCAGGGGCAGGAGCAGGTTCGGGTTCAGGCGG
JMFF023C10- TATTGGATTAGGTGGTAGCGGTAGTGGGTCAGGGGCAGGAGCAGGTTCGGGTTCAGGCGG
rJMFF023C10+ TATTGGATTAGGTGGTAGCGGTAGTGGGTCAGGGGCAGGAGCAGGTTCGGGTTCAGGCGG
                      ____________________________________________________________
consensus TATTGGATTAGGTGGTAGCGGTAGTGGGTCAGGGGCAGGAGCAGGTTCGGGTTCAGGCGG
 
. : . : . : . : . : . :
rJMFF047I22+ TGGCTCCAGTAGTTCAAGCTCGAGCTCGAGTTCAAGTTCGAGTTCTAGCTCTGGTGGTGG
JMFF047I22- TGGCTCCAGTAGTTCAAGCTCGAGCTCGAGTTCAAGTTCGAGTTCTAGCTCTGGTGGTGG
JMFF023C10- TGGCTCCAGTAGTTCAAGCTCGAGCTCGAGTTCAAGTTCGAGTTCTAGCTCTGGTGGTGG
rJMFF023C10+ TGGCTCCAGTAGTTCAAGCTCGAGCTCGAGTTCAAGTTCGAGTTCTAGCTCTGGTGGTGG
                      ____________________________________________________________
consensus TGGCTCCAGTAGTTCAAGCTCGAGCTCGAGTTCAAGTTCGAGTTCTAGCTCTGGTGGTGG
 
. : . : . : . : . : . :
rJMFF047I22+ TGG
JMFF047I22- TGG
JMFF023C10- TGGGTGGGGCTGGATCCGAAGCCGGATCCTCTGCCGGGTCGTATGCCGGATCAAGATCCG
rJMFF023C10+ T-GGTGGGGCTGGATCCGAAGCCGGATCCTCTGCCGGGTCGTATGCCGGATCAAGATCCG
                      ____________________________________________________________
consensus TGGGTGGGGCTGGATCCGAAGCCGGATCCTCTGCCGGGTCGTATGCCGGATCAAGATCCG
 
. : . : . : . : . : . :
JMFF023C10- GATCGGGCGGCTACGG
rJMFF023C10+ GATCGGGCGGCTACGGAGGTGGACAGGGAAGTGGCTACGGTGGAGGTAGCGGCAGGCACT
                      ____________________________________________________________
consensus GATCGGGCGGCTACGGAGGTGGACAGGGAAGTGGCTACGGTGGAGGTAGCGGCAGGCACT
 
. : . : . : . : . : . :
rJMFF023C10+ AAAAGCTTGGGCTTGCCACTTCATGTTACGTTATTAACACACTACTAGATTGGAATAAAA
                      ____________________________________________________________
consensus AAAAGCTTGGGCTTGCCACTTCATGTTACGTTATTAACACACTACTAGATTGGAATAAAA
 
. : . : . : . : . : . :
rJMFF023C10+ TAAATAAAGAAATAAAATAGTTGTATTAATAATATTATCATATGATGTCCTATATATATG
                      ____________________________________________________________
consensus TAAATAAAGAAATAAAATAGTTGTATTAATAATATTATCATATGATGTCCTATATATATG
 
. : . : . : . : . : . :
rJMFF023C10+ TGTGTTTATAGTTTGAATTATCTTATTATTCTCGAGTCTGATCTGTGGTCGGGTCTGTAG
                      ____________________________________________________________
consensus TGTGTTTATAGTTTGAATTATCTTATTATTCTCGAGTCTGATCTGTGGTCGGGTCTGTAG
 
. : . : . : . : . : . :
rJMFF023C10+ TGGTGTTGTAATGTTGTCTGGTTCCTTCTCTTTGTCCATAAAAATATATATATGAAAAGT
                      ____________________________________________________________
consensus TGGTGTTGTAATGTTGTCTGGTTCCTTCTCTTTGTCCATAAAAATATATATATGAAAAGT