Previous Contig 009279:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022P16Sequence267001129 (2)731009279 (2)gb:AB005230_15092343e-60Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAC12.>gb:AY039854_1560
JMFF036E03Sequence285001129 (2)594009279 (2)gb:AB005230_15092342e-38Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAC12.>gb:AY039854_1560

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF022P16+ GACGGAGGACA
                      ____________________________________________________________
consensus GACGGAGGACA
 
. : . : . : . : . : . :
rJMFF022P16+ GAGTGGTCATTTACTTCACGAGCCTCCGAGGAATCCGGAGAACNTTCGAGGATTGCTACA
                      ____________________________________________________________
consensus GAGTGGTCATTTACTTCACGAGCCTCCGAGGAATCCGGAGAACNTTCGAGGATTGCTACA
 
. : . : . : . : . : . :
rJMFF022P16+ CTGTTAGAATGATCCTTAAAAGCTTCAGAGTCCATGTCGATGAGAGGGACATTTCCATGG
                      ____________________________________________________________
consensus CTGTTAGAATGATCCTTAAAAGCTTCAGAGTCCATGTCGATGAGAGGGACATTTCCATGG
 
. : . : . : . : . : . :
rJMFF036E03+ ACAGTGCGTACAAGAAGGAACTCCAAAACATTCTCGGCGAGAAAAACCTCACTTTGCCGC
rJMFF022P16+ ACAGTGCGTACAAGAAGGAACTCCAAAACATTCTCGGCGAGAAAAACCTCACTTTGCCGC
                      ____________________________________________________________
consensus ACAGTGCGTACAAGAAGGAACTCCAAAACATTCTCGGCGAGAAAAACCTCACTTTGCCGC
 
. : . : . : . : . : . :
rJMFF036E03+ AGGTTTTCATCAAAGGAAACTACATTGGCGGCGCCGAAGTGATCAAGCAAATGAATGAAG
rJMFF022P16+ AGGTTTTCATCAAAGGAAACTACATTGGCGGCGCCGAAGTGATCAAGCAAATGAATGAAG
                      ____________________________________________________________
consensus AGGTTTTCATCAAAGGAAACTACATTGGCGGCGCCGAAGTGATCAAGCAAATGAATGAAG
 
. : . : . : . : . : . :
rJMFF036E03+ TGGGAGAGCTCTCCAGATTGCTTCGAGGGCTCCCCATTCGCCCCCCGGGATTCATCTGTC
rJMFF022P16+ TGGGAGAGCTCTCCAGATTGCTTCGAGGGCTCCCCATTCGCCCCCCGGGATTCATCTGTC
                      ____________________________________________________________
consensus TGGGAGAGCTCTCCAGATTGCTTCGAGGGCTCCCCATTCGCCCCCCGGGATTCATCTGTC
 
. : . : . : . : . : . :
rJMFF036E03+ AAGGCTGCGGGGATGCAAGGTTCATTCCTTGCTCGAATTGCAGTGGGAGCCGGAAACTGT
rJMFF022P16+ AAGGCTGCGGGGATGCAAGGTTCATTCCTTGCTCGAATTGCAGTGGGAGCCGGAAACTGT
                      ____________________________________________________________
consensus AAGGCTGCGGGGATGCAAGGTTCATTCCTTGCTCGAATTGCAGTGGGAGCCGGAAACTGT
 
. : . : . : . : . : . :
rJMFF036E03+ TCGATGAGTACGAGGAACAGCTTAGGAGGTGCCCGGATTGCAACGAGAATGGCCTCGTTC
rJMFF022P16+ TCGATGAGTACGAGGAACAGCTTAGGAGGTGCCCGGATTGCAACGAGAATGGCCTCGTTC
                      ____________________________________________________________
consensus TCGATGAGTACGAGGAACAGCTTAGGAGGTGCCCGGATTGCAACGAGAATGGCCTCGTTC
 
. : . : . : . : . : . :
rJMFF036E03+ GCTGTCCTCTTTGCTGCGGTTGATATGATCTTCATAATCTCGTGAGTCATTCATCTCGTT
rJMFF022P16+ GCTGTCCTCTTTGCTGCGGTTGATATGATCTTCATAATCTCGTGAGTCATTCATCTCGTT
                      ____________________________________________________________
consensus GCTGTCCTCTTTGCTGCGGTTGATATGATCTTCATAATCTCGTGAGTCATTCATCTCGTT
 
. : . : . : . : . : . :
rJMFF036E03+ ATGGTGTGCTCCTTAGCTTTTGGTATCAGTAAAAATCGAATAGGCTTTACATCCAAGACT
rJMFF022P16+ ATGGTGTGCTCCTTAGCTTTTGGTATCAGTAAAAATCGAATAGGCTTTACATCCAAGACT
                      ____________________________________________________________
consensus ATGGTGTGCTCCTTAGCTTTTGGTATCAGTAAAAATCGAATAGGCTTTACATCCAAGACT
 
. : . : . : . : . : . :
rJMFF036E03+ ATATATATATTATGGTTATGGCGTGTTAAGTGATTGTACATATTGCGTGTGAAGGTTTGT
rJMFF022P16+ ATATATATATTATGGTTATGGCGTGTTAAGTGATTGTACATATTGCGTGTGAAGGTTTGT
                      ____________________________________________________________
consensus ATATATATATTATGGTTATGGCGTGTTAAGTGATTGTACATATTGCGTGTGAAGGTTTGT
 
. : . : . : . : . : . :
rJMFF036E03+ GTTCCGGGTGACACCTCGTTAACCCAATGGTTTGTAAAGGTTGGCACCAACTTGGAGTGG
rJMFF022P16+ GTTCCGGGTGACACCTCGTTAACCCAATGGTTTGTAAAGGTTGGCACCAACTTGGAGTGG
                      ____________________________________________________________
consensus GTTCCGGGTGACACCTCGTTAACCCAATGGTTTGTAAAGGTTGGCACCAACTTGGAGTGG
 
. : . : . : . : . : . :
rJMFF036E03+ GTGTTTGGTCTTAAGGATGATGAAAATCTATTACAAAATTCGAAAAAGACAATA
rJMFF022P16+ GTGTTTGGTCTTAAGGATGATGAAAATCTATTACAAAATTCGAAAAAGACAATAAAATAG
                      ____________________________________________________________
consensus GTGTTTGGTCTTAAGGATGATGAAAATCTATTACAAAATTCGAAAAAGACAATAAAATAG