Previous Contig 009277:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010F15Sequence653009277 (10)pir|T08000|T080005e-55translation initiation factor eIF-1A - common sainfoin>gb:AF026804_1762213 Onobr726009277 (10)gb:AY052744_15629046e-51Arabidopsis thaliana At2g04520/T1O3.7 mRNA, complete cds.>gb:AF378900_1793485 Ar
JMFF014E22Sequence513009277 (10)gb:AY052744_15629043e-51Arabidopsis thaliana At2g04520/T1O3.7 mRNA, complete cds.>gb:AF378900_1793485 Ar688009277 (10)gb:AY052744_15629046e-51Arabidopsis thaliana At2g04520/T1O3.7 mRNA, complete cds.>gb:AF378900_1793485 Ar
JMFF014J14Sequence518009277 (10)pir|T08000|T080003e-55translation initiation factor eIF-1A - common sainfoin>gb:AF026804_1762213 Onobr714009277 (10)gb:AY052744_15629046e-51Arabidopsis thaliana At2g04520/T1O3.7 mRNA, complete cds.>gb:AF378900_1793485 Ar
JMFF022N23Sequence445009277 (10)gb:AY052744_15629043e-50Arabidopsis thaliana At2g04520/T1O3.7 mRNA, complete cds.>gb:AF378900_1793485 Ar729009277 (10)gb:AY052744_15629047e-51Arabidopsis thaliana At2g04520/T1O3.7 mRNA, complete cds.>gb:AF378900_1793485 Ar
JMSF030J17Sequence666009277 (10)gb:AY052744_15629045e-51Arabidopsis thaliana At2g04520/T1O3.7 mRNA, complete cds.>gb:AF378900_1793485 Ar659009277 (10)gb:AY052744_15629045e-51Arabidopsis thaliana At2g04520/T1O3.7 mRNA, complete cds.>gb:AF378900_1793485 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF030J17- AAG
JMSF030J17+ TCTATCAAAG
rJMFF014E22- TTGCAGTATTGTTGTAGTTGTTCTATCAAAG
                      ____________________________________________________________
consensus TTGCAGTATTGTTGTAGTTGTTCTATCAAAG
 
. : . : . : . : . : . :
rJMSF030J17- CATAAACTTTGTACATACACCCAATGCACAACGTTACACATAAGTAGCTCTCTCTCTATT
JMSF030J17+ CATAAACTTNGTACATACACCCAATGCACAACGTTACACATAAGTAGCTCTCTCTCTATT
rJMFF014E22- CATAAACTTTGTACATACACCCAATGCACAACGTTACACATAAGTAGCTCTCTCTCTATT
JMFF010F15+ CCCAATGCACAACGTTACACATAAGTAGCTCTCTCTNTATT
                      ____________________________________________________________
consensus CATAAACTTTGTACATACACCCAATGCACAACGTTACACATAAGTAGCTCTCTCTCTATT
 
. : . : . : . : . : . :
rJMFF014J14- TTTTA
rJMSF030J17- CATTCATATAATGATAGAATGCAAGGCAAACTAAGACATGAATGGTAAGTGCAAATTTTA
JMSF030J17+ CATTCATATAATGATAGAATGCAAGGCAAACTAAGACATGAATGGTAAGTGCAAATTTTA
rJMFF014E22- CATTCATATAATGATAGAATGCAAGGCAAACTAAGACATGAATGGTAAGTGCAAATTTTA
JMFF010F15+ CATTCATATAATGATAGAATGCAAGGCAAACTAAGACATGAATGGTAAGTGCAAATTTTA
rJMFF010F15- TTTTA
rJMFF022N23- TTTTA
                      ____________________________________________________________
consensus CATTCATATAATGATAGAATGCAAGGCAAACTAAGACATGAATGGTAAGTGCAAATTTTA
 
. : . : . : . : . : . :
rJMFF014J14- GATCTTGTCAATGTCCTCATCCTCGAACTCAATGTAATCATCAGCACCACCATCAT-CCT
rJMSF030J17- GATCTTGTCAATGTCCTCATCCTCGAACTCAATGTAATCATCAGCACCACCATCAT-CCT
JMSF030J17+ GATCTTGTCAATGTCCTCATCCTCGAACTCAATGTAATCATCAGCACCACCATCAT-CCT
rJMFF014E22- GATCTTGTCAATGTCCTCATCCTCGAACTCAATGTAATCATCAGCACCACCATCAT-CCT
JMFF014J14+ CTCGAACTCAATGTAATCATCAGCACCACCATCATCCCT
JMFF014E22+ GAACTCAATGTAATCATCAGCACCACCATCAT-CCT
JMFF010F15+ GATCTNGTCAATGTCCTCATCCTCGAACTCAATGTAATCATCAGCACCACCATCATCCCT
rJMFF010F15- GATCTTGTCAATGTCCTCATCCTCGAACTCAATGTAATCATCAGCACCACCATCAT-CCT
rJMFF022N23- GATCTTGTCAATGTCCTCATCCTCGAACTCAATGTAATCATCAGCACCACCATCAT-CCT
                      ____________________________________________________________
consensus GATCTTGTCAATGTCCTCATCCTCGAACTCAATGTAATCATCAGCACCACCATCAT-CCT
 
. : . : . : . : . : . :
rJMFF014J14- CTTCATCCAAACCACCAGCAATACCTTCATTAAGCCTAGTGTTCTCTGGCAACTCTCCAT
rJMSF030J17- CTTCATCCAAACCACCAGCAATACCTTCATTAAGCCTAGTGTTCTCTGGCAACTCTCCAT
JMSF030J17+ CTTCATCCAAACCACCAGCAATACCTTCATTAAGCCTAGTGTTCTCTGGCAACTCTCCAT
rJMFF014E22- CTTCATCCAAACCACCAGCAATACCTTCATTAAGCCTAGTGTTCTCTGGCAACTCTCCAT
JMFF014J14+ CTTCATCCAAACCACCAGCAATACCTTCATTAAGCCTAGTGTTCTCTGGCAACTCTCCAT
JMFF014E22+ CTTCATCCAAACCACCAGCAATACCTTCATTAAGCCTAGTGTTCTCTGGCAACTCTCCAT
JMFF010F15+ CTTCATCCAAACCACCAGCAATACCTTCATTAAGCCTAGTGTTCTCTGGCAACTCTCCAT
rJMFF010F15- CTTCATCCAAACCACCAGCAATACCTTCATTAAGCCTAGTGTTCTCTGGCAACTCTCCAT
JMFF022N23+ CCTAGTGTTCTCTGGCAACTCTCCAT
rJMFF022N23- CTTCATCCAAACCACCAGCAATACCTTCATTAAGCCTAGTGTTCTCTGGCAACTCTCCAT
                      ____________________________________________________________
consensus CTTCATCCAAACCACCAGCAATACCTTCATTAAGCCTAGTGTTCTCTGGCAACTCTCCAT
 
. : . : . : . : . : . :
rJMFF014J14- ATGCCTTCAGCAACCTCGCCTCATCTGGCATGTACTTGAGAATCACATCAGCCTTATCAT
rJMSF030J17- ATGCCTTCAGCAACCTCGCCTCATCTGGCATGTACTTGAGAATCACATCAGCCTTATCAT
JMSF030J17+ ATGCCTTCAGCAACCTCGCCTCATCTGGCATGTACTTGAGAATCACATCAGCCTTATCAT
rJMFF014E22- ATGCCTTCAGCAACCTCGCCTCATCTGGCATGTACTTGAGAATCACATCAGCCTTATCAT
JMFF014J14+ ATGCCTTCAGCAACCTCGCCTCATCTGGCATGTACTTGAGAATCACATCAGCCTTATCAT
JMFF014E22+ ATGCCTTCAGCAACCTCGCCTCATCTGGCATGTACTTGAGAATCACATCAGCCTTATCAT
JMFF010F15+ ATGCCTTCAGCAACCTCGCCTCATCTGGCATGTACTTGAGAATCACATCAGCCTTATCAT
rJMFF010F15- ATGCCTTCAGCAACCTCGCCTCATCTGGCATGTACTTGAGAATCACATCAGCCTTATCAT
JMFF022N23+ ATGCCTTCAGCAACCTCGCCTCATCTGGCATGTACTTGAGAATCACATCAGCCTTATCAT
rJMFF022N23- ATGCCTTCAGCAACCTCGCCTCATCTGGCATGTACTTGAGAATCACATCAGCCTTATCAT
                      ____________________________________________________________
consensus ATGCCTTCAGCAACCTCGCCTCATCTGGCATGTACTTGAGAATCACATCAGCCTTATCAT
 
. : . : . : . : . : . :
rJMFF014J14- CCTGATAGTCCCGGAGACCGACGAGTATGATGTCACCGGCGGCGATCCAGACCTTCTTGT
rJMSF030J17- CCTGATAGTCCCGGAGACCGACGAGTATGATGTCACCGGCGGCGATCCAGACCTTCTTGT
JMSF030J17+ CCTGATAGTCCCGGAGACCGACGAGTATGATGTCACCGGCGGCGATCCAGACCTTCTTGT
rJMFF014E22- CCTGATAGTCCCGGAGACCGACGAGTATGATGTCACCGGCGGCGATCCAGACCTTCTTGT
JMFF014J14+ CCTGATAGTCCCGGAGACCGACGAGTATGATGTCACCGGCGGCGATCCAGACCTTCTTGT
JMFF014E22+ CCTGATAGTCCCGGAGACCGACGAGTATGATGTCACCGGCGGCGATCCAGACCTTCTTGT
JMFF010F15+ CCTGATAGTCCCGGAGACCGACGAGTATGATGTCACCGGCGGCGATCCAGACCTTCTTGT
rJMFF010F15- CCTGATAGTCCCGGAGACCGACGAGTATGATGTCACCGGCGGCGATCCAGACCTTCTTGT
JMFF022N23+ CCTGATAGTCCCGGAGACCGACGAGTATGATGTCACCGGCGGCGATCCAGACCTTCTTGT
rJMFF022N23- CCTGATAGTCCCGGAGACCGACGAGTATGATGTCACCGGCGGCGATCCAGACCTTCTTGT
                      ____________________________________________________________
consensus CCTGATAGTCCCGGAGACCGACGAGTATGATGTCACCGGCGGCGATCCAGACCTTCTTGT
 
. : . : . : . : . : . :
rJMFF014J14- GCATCTTTCCACGGATGTGACAAAGGCGCTTTGTGCCGTCGATGCACATAGCCTCGCAGC
rJMSF030J17- GCATCTTTCCACGGATGTGACAAAGGCGCTTTGTGCCGTCGATGCACATAGCCTCGCAGC
JMSF030J17+ GCATCTTTCCACGGATGTGACAAAGGCGCTTTGTGCCGTCGATGCACATAGCCTCGCAGC
rJMFF014E22- GCATCTTTCCACGGATGTGACAAAGGCGCTTTGTGCCGTCGATGCACATAGCCTCGCAGC
JMFF014J14+ GCATCTTTCCACGGATGTGACAAAGGCGCTTTGTGCCGTCGATGCACATAGCCTCGCAGC
JMFF014E22+ GCATCTTTCCACGGATGTGACAAAGGCGCTTTGTGCCGTCGATGCACATAGCCTCGCAGC
JMFF010F15+ GCATCTTTCCACGGATGTGACAAAGGCGCTTTGTGCCGTCGATGCACATAGCCTCGCAGC
rJMFF010F15- GCATCTTTCCACGGATGTGACAAAGGCGCTTTGTGCCGTCGATGCACATAGCCTCGCAGC
JMFF022N23+ GCATCTTTCCACGGATGTGACAAAGGCGCTTTGTGCCGTCGATGCACATAGCCTCGCAGC
rJMFF022N23- GCATCTTTCCACGGATGTGACAAAGGCGCTTTGTGCCGTCGATGCACATAGCCTCGCAGC
                      ____________________________________________________________
consensus GCATCTTTCCACGGATGTGACAAAGGCGCTTTGTGCCGTCGATGCACATAGCCTCGCAGC
 
. : . : . : . : . : . :
rJMFF014J14- GACCGTTACCAAGCATACGGAGGACCTGAGCGTACTCTTGGCCGTCCTCTTTGAAAACCA
rJMSF030J17- GACCGTTACCAAGCATACGGAGGACCTGAGCGTACTCTTGGCCGTCCTCTTTGAAAACCA
JMSF030J17+ GACCGTTACCAAGCATACGGAGGACCTGAGCGTACTCTTGGCCGTCCTCTTTGAAAACCA
rJMFF014E22- GACCGTTACCAAGCATACGGAGGACCTGAGCGTACTCTTGGCCGTCCTCTTTGAAAACCA
JMFF014J14+ GACCGTTACCAAGCATACGGAGGACCTGAGCGTACTCTTGGCCGTCCTCTTTGAAAACCA
JMFF014E22+ GACCGTTACCAAGCATACGGAGGACCTGAGCGTACTCTTGGCCGTCCTCTTTGAAAACCA
JMFF010F15+ GACCGTTACCAAGCATACGGAGGACCTGAGCGTACTCTTGGCCGTCCTCTTTGAAAACCA
rJMFF010F15- GACCGTTACCAAGCATACGGAGGACCTGAGCGTACTCTTGGCCGTCCTCTTTGAAAACCA
JMFF022N23+ GACCGTTACCAAGCATACGGAGGACCTGAGCGTACTCTTGGCCGTCCTCTTTGAAAACCA
rJMFF022N23- GACCGTTACCAAGCATACGGAGGACCTGAGCGTACTCTTGGCCGTCCTCTTTGAAAACCA
                      ____________________________________________________________
consensus GACCGTTACCAAGCATACGGAGGACCTGAGCGTACTCTTGGCCGTCCTCTTTGAAAACCA
 
. : . : . : . : . : . :
rJMFF014J14- GCTCTCTCTTCTCATCGTCAGCCTCATTCTTTCCCCTCTTCCTGTTCTTACCTCCCTTTC
rJMSF030J17- GCTCTCTCTTCTCATCGTCAGCCTCATTCTTTCCCCTCTTCCTGTTCTTACCTCCCTTTC
JMSF030J17+ GCTCTCTCTTCTCATCGTCAGCCTCATTCTTTCCCCTCTTCCTGTTCTTACCTCCCTTTC
rJMFF014E22- GCTCTCTCTTCTCATCGTCAGCCTCATTCTTTCCCCTCTTCCTGTTCTTACCTCCCTTTC
JMFF014J14+ GCTCTCTCTTCTCATCGTCAGCCTCATTCTTTCCCCTCTTCCTGTTCTTACCTCCCTTTC
JMFF014E22+ GCTCTCTCTTCTCATCGTCAGCCTCATTCTTTCCCCTCTTCCTGTTCTTACCTCCCTTTC
JMFF010F15+ GCTCTCTCTTCTCATCGTCAGCCTCATTCTTTCCCCTCTTCCTGTTCTTACCTCCCTTTC
rJMFF010F15- GCTCTCTCTTCTCATCGTCAGCCTCATTCTTTCCCCTCTTCCTGTTCTTACCTCCCTTTC
JMFF022N23+ GCTCTCTCTTCTCATCGTCAGCCTCATTCTTTCCCCTCTTCCTGTTCTTACCTCCCTTTC
rJMFF022N23- GCTCTCTCTTCTCATCGTCAGCCTCATTCTTTCCCCTCTTCCTGTTCTTACCTCCCTTTC
                      ____________________________________________________________
consensus GCTCTCTCTTCTCATCGTCAGCCTCATTCTTTCCCCTCTTCCTGTTCTTACCTCCCTTTC
 
. : . : . : . : . : . :
rJMFF014J14- CCTTGTTCTTCGGCATGGTTTCTTCCGATTCTTGCCTTGCCTTCTTCTACGAAACCCTAA
rJMSF030J17- CCTTGTTCTTCGGCATGGTTTCTTCCGATTCTTGCCTTGCCTTCTTCTACGAAACCCTAA
JMSF030J17+ CCTTGTTCTTCGGCATGGTTTCTTCCGATTCTTGCCTTGCCTTCTTCTACGAAACCCTAA
rJMFF014E22- CCTTGTTCTTCGGCATGGTTTCTTCCGATTCTTGCCTTGCCTTCTTCTA-GAAACCCTAA
JMFF014J14+ CCTTGTTCTTCGGCATGGTTTCTTCCGATTCTTGCCTTGCCTTCTTCTACGAAACCCTAA
JMFF014E22+ CCTTGTTCTTCGGCATGGTTTCTTCCGATTCTTGCCTTGCCTTCTTCTA-GAAACCCTAA
JMFF010F15+ CCTTGTTCTTCGGCATGGTTTCTTCCGATTCTTGCCTTGCCTTCTTCTACGAAACCCTAA
rJMFF010F15- CCTTGTTCTTCGGCATGGTTTCTTCCGATTCTTGCCTTGCCTTCTTCTACGAAACCCTAA
JMFF022N23+ CCTTGTTCTTCGGCATGGTTTCTTCCGATTCTTGCCTTGCCTTCTTCTACGAAACCCTAA
rJMFF022N23- CCTTGTTCTTCGGCATGGTTTCTTCCGATTCTTGCCTTGCCTTCTTCTACGAAACCCTAA
                      ____________________________________________________________
consensus CCTTGTTCTTCGGCATGGTTTCTTCCGATTCTTGCCTTGCCTTCTTCTACGAAACCCTAA
 
. : . : . : . : . : . :
rJMFF014J14- ACCTGGTGTGATAAGATGAGAGAGAGAGATAGA
rJMSF030J17- ACCTGGTGTGATAAGATGAGAGAGAGAGATAGAAACCATAGGACAGAGAAGCTC
JMSF030J17+ ACCTGGTGTGATAAGATGAGAGAGAGAGATAGAAACCATAGGACAGAGAAGCTC
rJMFF014E22- ACCTGGTGTGATAAGATGAGAGAGAGAGATAGAAACCATAGGACAGAGAAGCTCTC
JMFF014J14+ ACCTGGTGTGATAAGATGAGAGAGAGAGATAGAAACCATAGGACAGAGAAGCTCTC
JMFF014E22+ ACCTGGTGTGATAAGATGAGAGAGAGAGATAGAAACCATAGGACAGAGAAGCTCTC
JMFF010F15+ ACCTGGTGTGATAAGATGAGAGAGAGAGATAGAAACCATAGGACAGAGAAGCTCTCAAT
rJMFF010F15- ACCTGGTGTGATAAGATGAGAGAGAGAGATAGAAACCATAGGACAGAGAAGCTCTCAAT
JMFF022N23+ ACCTGGTGTGATAAGATGAGAGAGAGAGATAGAAACCATAGGACAGAGAAGCTCTCAAT
rJMFF022N23- ACCTGGTGTGATAAGATGAGAGAGAGAGATAGAAACCATAGGACAGAGAAGCTCTCAATC
                      ____________________________________________________________
consensus ACCTGGTGTGATAAGATGAGAGAGAGAGATAGAAACCATAGGACAGAGAAGCTCTCAATC