Previous Contig 009272:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022M09Sequence588009272 (2)gb:AY136438_15819381e-42Arabidopsis thaliana unknown protein mRNA, complete cds.>gb:BT000223_1634501 Ara718009272 (2)gb:AY136438_15819386e-71Arabidopsis thaliana unknown protein mRNA, complete cds.>gb:BT000223_1634501 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF022M09- GGTTTCTTCTCTCCCGGAAGGAATCCCTCAATATTCCATCGT
                      ____________________________________________________________
consensus GGTTTCTTCTCTCCCGGAAGGAATCCCTCAATATTCCATCGT
 
. : . : . : . : . : . :
JMFF022M09- CTATCCACAAACAACAATGCCTGATACCTCTGCTCTATGTTTCTCCACCTTCTCTTCAAT
                      ____________________________________________________________
consensus CTATCCACAAACAACAATGCCTGATACCTCTGCTCTATGTTTCTCCACCTTCTCTTCAAT
 
. : . : . : . : . : . :
JMFF022M09- CCTGCCCTCTAAAGAACTCATACCCTCTTCTTCATTCGCTTCCTTTTCTTTTCTCCCGCT
                      ____________________________________________________________
consensus CCTGCCCTCTAAAGAACTCATACCCTCTTCTTCATTCGCTTCCTTTTCTTTTCTCCCGCT
 
. : . : . : . : . : . :
JMFF022M09- CCTAAAATGCCCGGGTCAACCGCCGACCCGTTCGGTCCGATTCACCGCCGCTAAGGCTTC
rJMFF022M09+ TAAAATGCCCGGGTCAACCGCCGACCCGTTCGGTCCGATTCACCGCCGCTAAGGCTTC
                      ____________________________________________________________
consensus CCTAAAATGCCCGGGTCAACCGCCGACCCGTTCGGTCCGATTCACCGCCGCTAAGGCTTC
 
. : . : . : . : . : . :
JMFF022M09- CGGTTCCAGCCATTTCCTCGGCGACGATGCATTCGGGAACTATCCTTGGGAACCCTCTGA
rJMFF022M09+ CGGTTCCAGCCATTTCCTCGGCGACGATGCATTCGGGAACTATCCTTGGGAACCCTCTGA
                      ____________________________________________________________
consensus CGGTTCCAGCCATTTCCTCGGCGACGATGCATTCGGGAACTATCCTTGGGAACCCTCTGA
 
. : . : . : . : . : . :
JMFF022M09- TCCTTCCGACTCCTCTGTGCAGTGGGTACAAGAGGACAAAATCACCCTGTTCACTGCTGA
rJMFF022M09+ TCCTTCCGACTCCTCTGTGCAGTGGGTACAAGAGGACAAAATCACCCTGTTCACTGCTGA
                      ____________________________________________________________
consensus TCCTTCCGACTCCTCTGTGCAGTGGGTACAAGAGGACAAAATCACCCTGTTCACTGCTGA
 
. : . : . : . : . : . :
JMFF022M09- TGGGTTGATACAAATTGGAGGGAATTTGGTTCCACAAGGTGTCTCTTCCTCTGATAAGAA
rJMFF022M09+ TGGGTTGATACAAATTGGAGGGAATTTGGTTCCACAAGGTGTCTCTTCCTCTGATAAGAA
                      ____________________________________________________________
consensus TGGGTTGATACAAATTGGAGGGAATTTGGTTCCACAAGGTGTCTCTTCCTCTGATAAGAA
 
. : . : . : . : . : . :
JMFF022M09- GCAAGGAAAAGTAAAAATGTCTCCAAGATTACAACGGTACCAAGAGAGTGATTACATGGA
rJMFF022M09+ GCAAGGAAAAGTAAAAATGTCTCCAAGATTACAACGGTACCAAGAGAGTGATTACATGGA
                      ____________________________________________________________
consensus GCAAGGAAAAGTAAAAATGTCTCCAAGATTACAACGGTACCAAGAGAGTGATTACATGGA
 
. : . : . : . : . : . :
JMFF022M09- TCCAGCTCAAGGCCTATGTTTGGGTGCACTTTTTGATATTGCAGCAACAAATGGTCTTGA
rJMFF022M09+ TCCAGCTCAAGGCCTATGTTTGGGTGCACTTTTTGATATTGCAGCAACAAATGGTCTTGA
                      ____________________________________________________________
consensus TCCAGCTCAAGGCCTATGTTTGGGTGCACTTTTTGATATTGCAGCAACAAATGGTCTTGA
 
. : . : . : . : . : . :
JMFF022M09- CATGGGTAGAAAGCTATGTATTCTGGGATTTTGCCGTTCTGTTGAGATGTTGAGTGATGT
rJMFF022M09+ CATGGGTAGAAAGCTATGTATTCTGGGATTTTGCCGTTCTGTTGAGATGTTGAGTGATGT
                      ____________________________________________________________
consensus CATGGGTAGAAAGCTATGTATTCTGGGATTTTGCCGTTCTGTTGAGATGTTGAGTGATGT
 
. : . : . : . : . : . :
JMFF022M09- TGTGGA
rJMFF022M09+ TGTGGAAGATATTGTAGTGGAACACGGTGGTGAGGTTGTCTCTGCAGAAAAAGCAAGCAA
                      ____________________________________________________________
consensus TGTGGAAGATATTGTAGTGGAACACGGTGGTGAGGTTGTCTCTGCAGAAAAAGCAAGCAA
 
. : . : . : . : . : . :
rJMFF022M09+ AGGCGGCATGCATGAAAAGCTAACCATGACAGTTTCAGTTCCTCTTCTCTGGGGGATCCC
                      ____________________________________________________________
consensus AGGCGGCATGCATGAAAAGCTAACCATGACAGTTTCAGTTCCTCTTCTCTGGGGGATCCC
 
. : . : . : . : . : . :
rJMFF022M09+ GCCTGCATCTGAAACACTCCATCTTGCTGTTCGAAGTGGTGGAGGCATTGTGGAGAAGGT
                      ____________________________________________________________
consensus GCCTGCATCTGAAACACTCCATCTTGCTGTTCGAAGTGGTGGAGGCATTGTGGAGAAGGT
 
. : . : . : . : . : . :
rJMFF022M09+ CTATTGGCGATGGGATTTCCTGTAAATGATTTAACTAAGATTCCTGTGCATATTGTGTAT
                      ____________________________________________________________
consensus CTATTGGCGATGGGATTTCCTGTAAATGATTTAACTAAGATTCCTGTGCATATTGTGTAT
 
. : . : . : . : . : . :
rJMFF022M09+ AGTATTCTTGTGCTACTATGTACAAAATTGAACTAACTGGTTAACTCTTACACTCATCAA
                      ____________________________________________________________
consensus AGTATTCTTGTGCTACTATGTACAAAATTGAACTAACTGGTTAACTCTTACACTCATCAA