Previous Contig 009271:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022L14Sequence536009271 (3)gb:AY085262_15703343e-09Arabidopsis thaliana clone 142094 mRNA, complete sequence.716009271 (3)gb:AY085262_15703347e-16Arabidopsis thaliana clone 142094 mRNA, complete sequence.
JMSF030G17Sequence694009271 (3)gb:AY085262_15703341e-30Arabidopsis thaliana clone 142094 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF022L14- AGCA
                      ____________________________________________________________
consensus AGCA
 
. : . : . : . : . : . :
JMFF022L14- GAAAGGCAAAATCTTTATGGGGAGGGAGGTTGCCAGTTTACGTATCGACAAGAAAGCCAA
                      ____________________________________________________________
consensus GAAAGGCAAAATCTTTATGGGGAGGGAGGTTGCCAGTTTACGTATCGACAAGAAAGCCAA
 
. : . : . : . : . : . :
JMFF022L14- TTTAAAACCAAATTGTAATGGCTCAGAGGCACTTGGAAGAGACGCGAATATTGAGGATTG
                      ____________________________________________________________
consensus TTTAAAACCAAATTGTAATGGCTCAGAGGCACTTGGAAGAGACGCGAATATTGAGGATTG
 
. : . : . : . : . : . :
JMFF022L14- CGGTGAGAAGCAAGATGTGCTATCTGTTAAGATCACGAATTGTGAGGCCGGGGAGGGAAA
                      ____________________________________________________________
consensus CGGTGAGAAGCAAGATGTGCTATCTGTTAAGATCACGAATTGTGAGGCCGGGGAGGGAAA
 
. : . : . : . : . : . :
JMFF022L14- AGTTGTGAAAGCTGACACTCTAAAGTCGAGTGACAAGAAGTCGAACTCAACCGTGAAGCC
                      ____________________________________________________________
consensus AGTTGTGAAAGCTGACACTCTAAAGTCGAGTGACAAGAAGTCGAACTCAACCGTGAAGCC
 
. : . : . : . : . : . :
JMFF022L14- TGCCTCGGAGTCCCCCGGCACTGGTCTTGTTGCCAAGCATAGTGCTAACGGTGTTGAGAC
                      ____________________________________________________________
consensus TGCCTCGGAGTCCCCCGGCACTGGTCTTGTTGCCAAGCATAGTGCTAACGGTGTTGAGAC
 
. : . : . : . : . : . :
JMFF022L14- TACTGATACTGGTTCGAACTGCTCTTTGAAATCGAACGATCTGCACTCCCCGTTGAGTGT
                      ____________________________________________________________
consensus TACTGATACTGGTTCGAACTGCTCTTTGAAATCGAACGATCTGCACTCCCCGTTGAGTGT
 
. : . : . : . : . : . :
JMFF022L14- AAAAAGATCACAGCAAATTCCTCTGGTGTCAAGAAATGATAGGAAACACCATGACGAAGA
                      ____________________________________________________________
consensus AAAAAGATCACAGCAAATTCCTCTGGTGTCAAGAAATGATAGGAAACACCATGACGAAGA
 
. : . : . : . : . : . :
JMFF022L14- AGATAGTTGGTCCTTGGCTTCTTCTGCTGCAGCATCTGTGAGAACTCTCAGATCTAAAAT
rJMSF030G17+ AAAAT
                      ____________________________________________________________
consensus AGATAGTTGGTCCTTGGCTTCTTCTGCTGCAGCATCTGTGAGAACTCTCAGATCTAAAAT
 
. : . : . : . : . : . :
JMFF022L14- TACTGTTCCAGTTGCTCCGACTTTTAAATCTGCAGATCGAGCTGCAAGACGC
rJMSF030G17+ TACTGTTCCAGTTGCTCCGACTTTTAAATNTGCAGATCGAGCTGCAAGACGCAGAGAGTT
                      ____________________________________________________________
consensus TACTGTTCCAGTTGCTCCGACTTTTAAATCTGCAGATCGAGCTGCAAGACGCAGAGAGTT
 
. : . : . : . : . : . :
rJMSF030G17+ TTACTCAAAGTTGGGGGAAAAACACAAAGCTTTGGAAGCAGAGAAACAAAAATGTGCTGC
                      ____________________________________________________________
consensus TTACTCAAAGTTGGGGGAAAAACACAAAGCTTTGGAAGCAGAGAAACAAAAATGTGCTGC
 
. : . : . : . : . : . :
rJMSF030G17+ CAGAACTAAGGAAGAAGAGGAAGCAGTTATAAAGCAGATTAGAAAGAACATGGTCTATAA
rJMFF022L14+ ACTAAGGAAGAAGAGGAAGCAGTTATAAAGCAGATTAGAAAGAACATGGTCTATAA
                      ____________________________________________________________
consensus CAGAACTAAGGAAGAAGAGGAAGCAGTTATAAAGCAGATTAGAAAGAACATGGTCTATAA
 
. : . : . : . : . : . :
rJMSF030G17+ GGCAAATCCAGTTCCAAGCTTTTACCATGAAGGGCCTCCACCAAAAGCCAAACTTAAGAA
rJMFF022L14+ GGCAAATCCAGTTCCAAGCTTTTACCATGAAGGGCCTCCACCAAAAGCCAAACTTAAGAA
                      ____________________________________________________________
consensus GGCAAATCCAGTTCCAAGCTTTTACCATGAAGGGCCTCCACCAAAAGCCAAACTTAAGAA
 
. : . : . : . : . : . :
rJMSF030G17+ ACTACCTCTCACTCGTGCAAAATCACCCAACCTTTCACGGAGAAAAAGCTGCAGTGATGC
rJMFF022L14+ ACTACCTCTCACTCGTGCAAAATCACCCAACCTTTCACGGAGAAAAAGCTGCAGTGATGC
                      ____________________________________________________________
consensus ACTACCTCTCACTCGTGCAAAATCACCCAACCTTTCACGGAGAAAAAGCTGCAGTGATGC
 
. : . : . : . : . : . :
rJMSF030G17+ TGTTGTTTCTCCAGAAGTGAAGCAAGTTTATGGTCGGGGTCGTCACAGCATTGGCGCTTA
rJMFF022L14+ TGTTGTTTCTCCAGAAGTGAAGCAAGTTTATGGTCGGGGTCGTCACAGCATTGGCGCTTA
                      ____________________________________________________________
consensus TGTTGTTTCTCCAGAAGTGAAGCAAGTTTATGGTCGGGGTCGTCACAGCATTGGCGCTTA
 
. : . : . : . : . : . :
rJMSF030G17+ CAGGCAAGGGAATACGAGCGCCATAACTCCCAAAAGTAAAGCCCTGGTGAACCGGGAGAA
rJMFF022L14+ CAGGCAAGGGAATACGAGCGCCATAACTCCCAAAAGTAAAGCCCTGGTGAACCGGGAGAA
                      ____________________________________________________________
consensus CAGGCAAGGGAATACGAGCGCCATAACTCCCAAAAGTAAAGCCCTGGTGAACCGGGAGAA
 
. : . : . : . : . : . :
rJMSF030G17+ TGTTAATGGAACTAGCAGTGCGAAACCAGTAAACGTTACAAGGAAAACTCCACCAAACCA
rJMFF022L14+ TGTTAATGGAACTAGCAGTGCGAAACCAGTAAACGTTACAAGGAAAACTCCACCAAACCA
                      ____________________________________________________________
consensus TGTTAATGGAACTAGCAGTGCGAAACCAGTAAACGTTACAAGGAAAACTCCACCAAACCA
 
. : . : . : . : . : . :
rJMSF030G17+ GGCAAAGGAAGCTCCTGCAAACGACTCGTCAGTGAAGGAGACGAATGCAAGTCCAACTAA
rJMFF022L14+ GGCAAAGGAAGCTCCTGCAAACGACTCGTCAGTGAAGGAGACGAATGCAAGTCCAACTAA
                      ____________________________________________________________
consensus GGCAAAGGAAGCTCCTGCAAACGACTCGTCAGTGAAGGAGACGAATGCAAGTCCAACTAA
 
. : . : . : . : . : . :
rJMSF030G17+ TGACGTAAAGGAAACTCCAGCCGAAGAGGTTAAGGAAAGTAATCGTACTATTATAGATTT
rJMFF022L14+ TGACGTAAAGGAAACTCCAGCCGAAGAGGTTAAGGAAAGTAATCGTACTATTATAGATTT
                      ____________________________________________________________
consensus TGACGTAAAGGAAACTCCAGCCGAAGAGGTTAAGGAAAGTAATCGTACTATTATAGATTT
 
. : . : . : . : . : . :
rJMSF030G17+ TCAGCCGAGCGGGCATATTGCTGCTCAATCATGAAGCAGTTTAGCTCC-TTTTTTTTGTG
rJMFF022L14+ TCAGCCGAGCGGGCATATTGCTGCTCAATCATGAAGCAGTTTAGCTCCTTTTTTTTTGTG
                      ____________________________________________________________
consensus TCAGCCGAGCGGGCATATTGCTGCTCAATCATGAAGCAGTTTAGCTCCTTTTTTTTTGTG
 
. : . : . : . : . : . :
rJMSF030G17+ TTTTTTATTGTACTTTTAGAGGAAAACGAA
rJMFF022L14+ TTTTTTATTGTACTTTTAGAGGAAAACGAACTGGACTCCTTAAAATGGTCATTTCCTTGG
                      ____________________________________________________________
consensus TTTTTTATTGTACTTTTAGAGGAAAACGAACTGGACTCCTTAAAATGGTCATTTCCTTGG
 
. : . : . : . : . : . :
rJMFF022L14+ TTGTTGGCAATGACTTGTTGATCAATCTGTGTTGTAAATTGTGTAGCAGTTTGTGTTTTT
                      ____________________________________________________________
consensus TTGTTGGCAATGACTTGTTGATCAATCTGTGTTGTAAATTGTGTAGCAGTTTGTGTTTTT
 
. : . : . : . : . : . :
rJMFF022L14+ TGGGTACATATTTGATGAAGAAGAGAGGCATGGAGGCATGGACTGACTTGTTTATAAACG
                      ____________________________________________________________
consensus TGGGTACATATTTGATGAAGAAGAGAGGCATGGAGGCATGGACTGACTTGTTTATAAACG