Previous Contig 009266:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022K03Sequence549014518634009266 (2)pir|H96712|H967122e-11probable DNA-binding protein T6L1.1 [imported] - Arabidopsis thaliana>gb:AE00517
JMFF030P01Sequence129009266 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF022K03+ ACCTCATCAAGAGCNTGAAGGGTCTTCGGTTAAA
                      ____________________________________________________________
consensus ACCTCATCAAGAGCNTGAAGGGTCTTCGGTTAAA
 
. : . : . : . : . : . :
rJMFF022K03+ AGCATTGCGGGCTGAAATCACCACCCTCGGCGGCCGCATGAGGAACGTGCTGTTCATCAC
                      ____________________________________________________________
consensus AGCATTGCGGGCTGAAATCACCACCCTCGGCGGCCGCATGAGGAACGTGCTGTTCATCAC
 
. : . : . : . : . : . :
rJMFF022K03+ CCGCGAAAACGACCGCGGCGGCGGGGGGGATTGCGACGGCGACGACGAGTCGTTGCAGTC
                      ____________________________________________________________
consensus CCGCGAAAACGACCGCGGCGGCGGGGGGGATTGCGACGGCGACGACGAGTCGTTGCAGTC
 
. : . : . : . : . : . :
rJMFF022K03+ CATAAGCTCCGTGGAAGACGCGCTGAGAGCGGTGATGGAGAGATCAAACGGCGGGGAAGA
                      ____________________________________________________________
consensus CATAAGCTCCGTGGAAGACGCGCTGAGAGCGGTGATGGAGAGATCAAACGGCGGGGAAGA
 
. : . : . : . : . : . :
rJMFF022K03+ CCAGTCAGGGAGTGTGAAGAGACAAAGAACTAATAATATTAACATATTTCAACAACACCA
                      ____________________________________________________________
consensus CCAGTCAGGGAGTGTGAAGAGACAAAGAACTAATAATATTAACATATTTCAACAACACCA
 
. : . : . : . : . : . :
rJMFF030P01+ ATTGATGAAGGGATCGTGATTTACATTATTTCAGATNTTTTGTTGGGTC
rJMFF022K03+ CAAATAATCTCATTGATGAAGGGATCGTGATTTACATTATTTCAGATGTTTTGTTGGGTC
                      ____________________________________________________________
consensus CAAATAATCTCATTGATGAAGGGATCGTGATTTACATTATTTCAGATGTTTTGTTGGGTC
 
. : . : . : . : . : . :
rJMFF030P01+ AGGATGTGGGGCCTTTGCAGTTGGGGATTCAACCTTTCGAGACGTTTGGTTAGTTGAAAT
rJMFF022K03+ AGGATGTGGGGCCTTTGCAGTTGGGGATTCAACCTTTCGAGACGTTTGGTTAGTTGAAAT
                      ____________________________________________________________
consensus AGGATGTGGGGCCTTTGCAGTTGGGGATTCAACCTTTCGAGACGTTTGGTTAGTTGAAAT
 
. : . : . : . : . : . :
rJMFF030P01+ TTCATCNCCANTAAGGAGAT
rJMFF022K03+ TTCATCACCACTAAGGAGATTATTATAAGCCAAGTTAGTGGTGAGTGTTTAATGTTTAAT
                      ____________________________________________________________
consensus TTCATCACCACTAAGGAGATTATTATAAGCCAAGTTAGTGGTGAGTGTTTAATGTTTAAT
 
. : . : . : . : . : . :
rJMFF022K03+ TTAGAGAATATTAATTACAAGCTAAGTTTAATTTCTTGGTTGTGGGGTTTATAATTTATG
                      ____________________________________________________________
consensus TTAGAGAATATTAATTACAAGCTAAGTTTAATTTCTTGGTTGTGGGGTTTATAATTTATG
 
. : . : . : . : . : . :
rJMFF022K03+ ATTATATATTGTGGAATGTGACAAAATTTATTTGTCACTTGATTAGTTGGTTGGCTTTCT
                      ____________________________________________________________
consensus ATTATATATTGTGGAATGTGACAAAATTTATTTGTCACTTGATTAGTTGGTTGGCTTTCT
 
. : . : . : . : . : . :
rJMFF022K03+ AATATTGAGATTGGGTGCAATGGTCAATTAATTAATTCCCTTCATTTAGATAATATGGGA
                      ____________________________________________________________
consensus AATATTGAGATTGGGTGCAATGGTCAATTAATTAATTCCCTTCATTTAGATAATATGGGA