Previous Contig 009264:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022H20Sequence496006328 (3)gb:AB022215_15150344e-36Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MCB17.>gb:AY050770_156691009264 (4)gb:AY060551_15648603e-13Arabidopsis thaliana AT4g14900/dl3490c mRNA, complete cds.
JMFF036L11Sequence502009264 (4)gb:AB022215_15150343e-31Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MCB17.>gb:AY050770_156
JMSF025M20Sequence583006328 (3)gb:AB022215_15150346e-36Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MCB17.>gb:AY050770_156736009264 (4)gb:AY060551_15648601e-27Arabidopsis thaliana AT4g14900/dl3490c mRNA, complete cds.
JMSF044E02Sequence567006328 (3)gb:AB022215_15150346e-36Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MCB17.>gb:AY050770_156815009264 (4)gb:AB022215_15150347e-36Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MCB17.>gb:AY050770_156

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044E02+ TCAGCAGAGGACAGCAGNTAGATGCTGTGC
                      ____________________________________________________________
consensus TCAGCAGAGGACAGCAGNTAGATGCTGTGC
 
. : . : . : . : . : . :
JMFF036L11+ CCGTTCCTCTTCTGAAAGATT
rJMSF044E02+ ATTTCAGTTGTGAAGTTGGCCTTGTTGACAAATTCCCTCCCGTTCCTNTTTTGAAAGATT
                      ____________________________________________________________
consensus ATTTCAGTTGTGAAGTTGGCCTTGTTGACAAATTCCCTCCCGTTCCTCTTTTGAAAGATT
 
. : . : . : . : . : . :
JMFF036L11+ TTCTGAAAGACGCGAAAAAATCTGCTGCTGCAATTCTTGAAGATCCTAGCAATTCTGGTC
rJMSF044E02+ TTNTGAAAGACGCGAAAAAATCTGCTGCTGCAATTCTTGAAGATCCTAGCAATTCTGGTC
rJMSF025M20+ TGAAAGACGCGAAAAAATCTGCTGCTGCAATTCTTGAAGATCCTAGCAATTCTGGTC
                      ____________________________________________________________
consensus TTCTGAAAGACGCGAAAAAATCTGCTGCTGCAATTCTTGAAGATCCTAGCAATTCTGGTC
 
. : . : . : . : . : . :
JMFF036L11+ GAGCTGCGCACCTGGCTGCAAAGAAAGAGCTATCAGCTGTTCGTTCGGTCCTCAAGTGCA
rJMSF044E02+ GAGCTGCGCACCTGGCTGCAAAGAAAGAGCTATCAGCTGTTCGTTCGGTCCTCAAGTGCA
rJMSF025M20+ GAGCTGCGCACCTGGCTGCAAAGAAAGAGCTATCAGCTGTTCGTTCGGTCCTCAAGTGCA
                      ____________________________________________________________
consensus GAGCTGCGCACCTGGCTGCAAAGAAAGAGCTATCAGCTGTTCGTTCGGTCCTCAAGTGCA
 
. : . : . : . : . : . :
JMFF036L11+ TTGAAGAGTACAAACTCGAAGCTGAGTTCCCTCCCGAAAACCTCAAAAAGCGCCTCGAGG
rJMSF044E02+ TTGAAGAGTACAAACTCGAAGCTGAGTTCCCTCCCGAAAACCTCAAAAAGCGCCTCGAGG
rJMSF025M20+ TTGAAGAGTACAAACTCGAAGCTGAGTTCCCTCCCGAAAACCTCAAAAAGCGCCTCGAGG
rJMFF022H20+ TCCCGAAAACCTCAAAAAGCGCCTCGAGG
                      ____________________________________________________________
consensus TTGAAGAGTACAAACTCGAAGCTGAGTTCCCTCCCGAAAACCTCAAAAAGCGCCTCGAGG
 
. : . : . : . : . : . :
JMFF036L11+ AGTTGGAGAAGTCCAAGACTGAGAAAAAGAAGACAGCAGCAACCACCGCCACTGCAGCCC
rJMSF044E02+ AGTTGGAGAAGTCCAAGACTGAGAAAAAGAAGACAGCAGCAACCACCGCCACTGCAGCCC
rJMSF025M20+ AGTTGGAGAAGTCCAAGACTGAGAAAAAGAAGACAGCAGCAACCACCGCCACTGCAGCCC
rJMFF022H20+ AGTTGGAGAAGTCCAAGACTGAGAAAAAGAAGACAGCAGCAACCACCGCCACTGCAGCCC
                      ____________________________________________________________
consensus AGTTGGAGAAGTCCAAGACTGAGAAAAAGAAGACAGCAGCAACCACCGCCACTGCAGCCC
 
. : . : . : . : . : . :
JMFF036L11+ CTGCGAACAAACGTACACGCGTCAACAATGGAGGCCCAATGCCCCCAGCCAAGGCTGGCC
rJMSF044E02+ CTGCGAACAAACGTACACGCGTCAACAATGGAGGCCCAATGCCCCCAGCCAAGGCTGGCC
rJMSF025M20+ CTGCGAACAAACGTACACGCGTCAACAATGGAGGCCCAATGCCCCCAGCCAAGGCTGGCC
rJMFF022H20+ CTGCGAACAAACGTACACGCGTCAACAATGGAGGCCCAATGCCCCCAGCCAAGGCTGGCC
                      ____________________________________________________________
consensus CTGCGAACAAACGTACACGCGTCAACAATGGAGGCCCAATGCCCCCAGCCAAGGCTGGCC
 
. : . : . : . : . : . :
JMFF036L11+ GCTCGACCAATGCTTACGTATCTTCTTTCCCATCAGCTCCCGCGTTTGTCAGGTCACCTC
rJMSF044E02+ GCTCGACCAATGCTTACGTATCTTCTTTCCCATCAGCTCCCGCGTTTGTCAGGTCACCTC
rJMSF025M20+ GCTCGACCAATGCTTACGTATCTTCTTTCCCATCAGCTCCCGCGTTTGTCAGGTCACCTC
rJMFF022H20+ GCTCGACCAATGCTTACGTATCTTCTTTCCCATCAGCTCCCGCGTTTGTCAGGTCACCTC
                      ____________________________________________________________
consensus GCTCGACCAATGCTTACGTATCTTCTTTCCCATCAGCTCCCGCGTTTGTCAGGTCACCTC
 
. : . : . : . : . : . :
JMFF036L11+ CACACACCCAATACCCTGTCGGAGTCCCAGCCTACCCGACATCTCCAGCCATGTATGTCC
rJMSF044E02+ CACACACCCAATACCCTGTCGGAGTCCCAGCCTACCCGACATCTCCAGCCATGTATGTCC
rJMSF025M20+ CACACACCCAATACCCTGTCGGAGTCCCAGCCTACCCGACATCTCCAGCCATGTATGTCC
rJMFF022H20+ CACACACCCAATACCCTGTCGGAGTCCCAGCCTACCCGACATCTCCAGCCATGTATGTCC
                      ____________________________________________________________
consensus CACACACCCAATACCCTGTCGGAGTCCCAGCCTACCCGACATCTCCAGCCATGTATGTCC
 
. : . : . : . : . : . :
JMFF036L11+ ACGGGGGAAGCAGAAGTCCCCCGTATGTGTACTCCCCCGAAGCTGCTCCTTACC
rJMSF044E02+ ACGGGGGAAGCAGAAGTCCCCCGTATGTGTACTCCCCCGAAGCTGCTCCTTACCCAGGCT
rJMSF025M20+ ACGGGGGAAGCAGAAGTCCCCCGTATGTGTACTCCCCCGAAGCTGCTCCTTACCCAGGCT
rJMFF022H20+ ACGGGGGAAGCAGAAGTCCCCCGTATGTGTACTCCCCCGAAGCTGCTCCTTACCCAGGCT
                      ____________________________________________________________
consensus ACGGGGGAAGCAGAAGTCCCCCGTATGTGTACTCCCCCGAAGCTGCTCCTTACCCAGGCT
 
. : . : . : . : . : . :
rJMSF044E02+ CCCCCTACTCACCATACGGAGGCTACAGCAATGCCGTGTCACCAGCTTACCATCAAGCTT
rJMSF025M20+ CCCCCTACTCACCATACGGAGGCTACAGCAATGCCGTGTCACCAGCTTACCATCAAGCTT
rJMFF022H20+ CCCCCTACTCACCATACGGAGGCTACAGCAATGCCGTGTCACCAGCTTACCATCAAGCTT
                      ____________________________________________________________
consensus CCCCCTACTCACCATACGGAGGCTACAGCAATGCCGTGTCACCAGCTTACCATCAAGCTT
 
. : . : . : . : . : . :
rJMSF044E02+ ACTACTGATAGAAGACGACATAACTGCCCGGGTTAAATATGGTGACTACTAATATCATGA
rJMSF025M20+ ACTACTGATAGAAGACGACATAACTGCCCGGGTTAAATATGGTGACTACTAATATCATGA
rJMFF022H20+ ACTACTGATAGAAGACGACATAACTGCCCGGGTTAAATATGGTGACTACTAATATCATGA
                      ____________________________________________________________
consensus ACTACTGATAGAAGACGACATAACTGCCCGGGTTAAATATGGTGACTACTAATATCATGA
 
. : . : . : . : . : . :
rJMSF044E02+ CGCGATCTAAATGTCTTTTAAATGGTTTGTAATCGCTAACTGTAATGGTAGATTTGTGCT
rJMSF025M20+ CGCGATCTAAATGTCTTTTAAATGGTTTGTAATCGCTAACTGTAATGGTAGATTTGTGCT
rJMFF022H20+ CGCGATCTAAATGTCTTTTAAATGGTTTGTAATCGCTAACTGTAATGGTAGATTTGTGCT
                      ____________________________________________________________
consensus CGCGATCTAAATGTCTTTTAAATGGTTTGTAATCGCTAACTGTAATGGTAGATTTGTGCT
 
. : . : . : . : . : . :
rJMSF044E02+ GTGTTAATCCTTAATATAGACATCTATAACTCTATTACTGATTCTTGCTTAGCAATGAGC
rJMSF025M20+ GTGTTAATCCTTAATATAGACATCTATAACTCTATTACTGATTCTTGCTTAGCAATGAGC
rJMFF022H20+ GTGTTAATCCTTAATATAGACATCTATAACTCTATTACTGATTCTTGCTTAGCAATGAGC
                      ____________________________________________________________
consensus GTGTTAATCCTTAATATAGACATCTATAACTCTATTACTGATTCTTGCTTAGCAATGAGC
 
. : . : . : . : . : . :
rJMSF044E02+ AGGTT
rJMSF025M20+ AGGTT
rJMFF022H20+ AGGTTGTATTTCTGATGTGGATCAAGTAAGTAATACAGTAGGTGTTTTGTGCCAAACTAG
                      ____________________________________________________________
consensus AGGTTGTATTTCTGATGTGGATCAAGTAAGTAATACAGTAGGTGTTTTGTGCCAAACTAG
 
. : . : . : . : . : . :
rJMFF022H20+ AAATGTGGAATATTTTCATCTGAATAACACAAGGAAGAAAAAGAAAGAAAAAATAAAAGG
                      ____________________________________________________________
consensus AAATGTGGAATATTTTCATCTGAATAACACAAGGAAGAAAAAGAAAGAAAAAATAAAAGG