Previous Contig 009262:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022H14Sequence519004379 (4)gb:AY088059_15730838e-04Arabidopsis thaliana clone 40787 mRNA, complete sequence.125009262 (3)
JMSF002A20Sequence309004379 (4)775009262 (3)gb:AY088059_15730839e-59Arabidopsis thaliana clone 40787 mRNA, complete sequence.
JMSF012H11Sequence495004379 (4)717009262 (3)gb:AY088059_15730838e-59Arabidopsis thaliana clone 40787 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012H11+ GGAGGAACCGACTGTACATACACTCCCGTGTACACTGAGATAAAGCCAGTGAGAGTACC
rJMSF002A20+ GGAACCGACTGTACATACACTCCCGTGTACACTGAGATAAAGCCAGTGAGAGTACC
                      ____________________________________________________________
consensus GGAGGAACCGACTGTACATACACTCCCGTGTACACTGAGATAAAGCCAGTGAGAGTACC
 
. : . : . : . : . : . :
rJMSF012H11+ ATTCCAAAAAGGATTGGGCCAAAAATTTTGCCAGCCTTCAGGAACTGGTGTTGACTTGGG
rJMSF002A20+ ATTCCAAAAAGGATTGGGCCAAAAATTTTGCCAGCCTTCAGGAACTGGTGTTGACTTGGG
                      ____________________________________________________________
consensus ATTCCAAAAAGGATTGGGCCAAAAATTTTGCCAGCCTTCAGGAACTGGTGTTGACTTGGG
 
. : . : . : . : . : . :
rJMSF012H11+ CTTCTTTGACATAAATGACCTATCAAAGCCCATTCCTGGAGAAAATGCTTTCCCGCTAGT
rJMSF002A20+ CTTCTTTGACATAAATGACCTATCAAAGCCCATTCCTGGAGAAAATGCTTTCCCGCTAGT
                      ____________________________________________________________
consensus CTTCTTTGACATAAATGACCTATCAAAGCCCATTCCTGGAGAAAATGCTTTCCCGCTAGT
 
. : . : . : . : . : . :
rJMSF012H11+ TATAGTAGCAGAGTCATGTGCATCAACTTCAGCGGATGAACAGCCTAATGAGCAACAGGC
rJMSF002A20+ TATAGTAGCAGAGTCATGTGCATCAACTTCAGCGGATGAACAGCCTAATGAGCAACAGGC
                      ____________________________________________________________
consensus TATAGTAGCAGAGTCATGTGCATCAACTTCAGCGGATGAACAGCCTAATGAGCAACAGGC
 
. : . : . : . : . : . :
rJMSF012H11+ CAACAAACTCCCGAATGCACAGATCACGGAGGCTATTATAGAGAAGAACAACGAGGACCA
rJMSF002A20+ CAACAAACTCCCGAATGCACAGATCACGGAGGCTATTATAGAGAAGAACAACGAGGACCA
                      ____________________________________________________________
consensus CAACAAACTCCCGAATGCACAGATCACGGAGGCTATTATAGAGAAGAACAACGAGGACCA
 
. : . : . : . : . : . :
rJMSF012H11+ CTTTCAAGTGAAAGTAATCAAGCAGATTTTATGGGTTGAGGGGGTCCGTTATGAGCTGCG
rJMSF002A20+ CTTTCAAGTGAAAGTAATCAAGCAGATTTTATGGGTTGAGGGGGTCCGTTATGAGCTGCG
                      ____________________________________________________________
consensus CTTTCAAGTGAAAGTAATCAAGCAGATTTTATGGGTTGAGGGGGTCCGTTATGAGCTGCG
 
. : . : . : . : . : . :
rJMSF012H11+ AGAAATTTATGGAATTAGCAAACCAGATGAAGAAACCATCAATGATGACTCGGGAAAAGA
rJMSF002A20+ AGAAATTTATGGAATTAGCAAACCAGATGAAGAAACCATCAATGATGACTCGGGAAAAGA
                      ____________________________________________________________
consensus AGAAATTTATGGAATTAGCAAACCAGATGAAGAAACCATCAATGATGACTCGGGAAAAGA
 
. : . : . : . : . : . :
rJMSF012H11+ GTGTGTCATTTGCATGACTGAACCGAAGGATACAGCAGTTTTGCCTTGTAGACATATGTG
rJMSF002A20+ GTGTGTCATTTGCATGACTGAACCGAAGGATACAGCAGTTTTGCCTTGTAGACATATGTG
                      ____________________________________________________________
consensus GTGTGTCATTTGCATGACTGAACCGAAGGATACAGCAGTTTTGCCTTGTAGACATATGTG
 
. : . : . : . : . : . :
rJMSF012H11+ TTTATGCAGTGAGTGCGCCAAAACTTTGAGGCTTCAATCAAATAAGTGCCCAATATGCCG
rJMSF002A20+ TTTATGCAGTGAGTGCGCCAAAACTTTGAGGCTTCAATCAAATAAGTGCCCAATATGCCG
                      ____________________________________________________________
consensus TTTATGCAGTGAGTGCGCCAAAACTTTGAGGCTTCAATCAAATAAGTGCCCAATATGCCG
 
. : . : . : . : . : . :
rJMSF012H11+ CCAACCCATTGAAGAACTTCTGGAGATTAAGGTTAACGAAGGTCCTAATGAAGCTTCGTA
rJMSF002A20+ CCAACCCATTGAAGAACTTCTGGAGATTAAGGTTAACGAAGGTCCTAATGAAGCTTCGTA
                      ____________________________________________________________
consensus CCAACCCATTGAAGAACTTCTGGAGATTAAGGTTAACGAAGGTCCTAATGAAGCTTCGTA
 
. : . : . : . : . : . :
rJMSF012H11+ GCATCAAAATAAGCTCGGATATGGCAAGGCAAAATCTGTGTATATGTGTCTGCAAAAGAA
rJMSF002A20+ GCATCAAAATAAGCTCGGATATGGCAAGGCAAAATCTGTGTATATGTGTCTGCAAAAGAA
                      ____________________________________________________________
consensus GCATCAAAATAAGCTCGGATATGGCAAGGCAAAATCTGTGTATATGTGTCTGCAAAAGAA
 
. : . : . : . : . : . :
rJMSF012H11+ TAATAGTTGGCGTTAGCCCGTTTTCATCATAGTTTTGTAACCAGGTGCCTTATCAAAT
rJMSF002A20+ TAATAGTTGGCGTTAGCCCGTTTTCATCATAGTTTTGTAACCAGGTGCCTTATCAAATTC
rJMFF022H14+ AATTC
                      ____________________________________________________________
consensus TAATAGTTGGCGTTAGCCCGTTTTCATCATAGTTTTGTAACCAGGTGCCTTATCAAATTC
 
. : . : . : . : . : . :
rJMSF002A20+ ACCAGGGATTGTATATAATTTATGAATAAGAAAGTTTTTCCAAATATCTTCATATTCTT
rJMFF022H14+ ACCAGGGATTGTATATAATTTATGAATAAGAAAGGTTTTCCAAATATCTTCATATTCTTT
                      ____________________________________________________________
consensus ACCAGGGATTGTATATAATTTATGAATAAGAAAGTTTTTCCAAATATCTTCATATTCTTT
 
. : . : . : . : . : . :
rJMFF022H14+ CTGGTTTGACATCCTTTTGAAACAGTTTCATCTTTCACCTTGGGCATGTTTTCTTATAAT
                      ____________________________________________________________
consensus CTGGTTTGACATCCTTTTGAAACAGTTTCATCTTTCACCTTGGGCATGTTTTCTTATAAT