Previous Contig 009256:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022F23Sequence543009256 (2)gb:AY655141_16202262e-04Solanum chacoense rapid alkalinization factor 5 (RALF5) mRNA, complete cds.712009256 (2)gb:AY655141_16202264e-04Solanum chacoense rapid alkalinization factor 5 (RALF5) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF022F23- GCTTCATACTTTATTCTACTATGCACTATATACATAGCCATACCTTTGCTCA
rJMFF022F23+ GCTTCATACTTTATTCTACTATGCACTATATACATAGCCATACCTTTGCTCA
                      ____________________________________________________________
consensus GCTTCATACTTTATTCTACTATGCACTATATACATAGCCATACCTTTGCTCA
 
. : . : . : . : . : . :
JMFF022F23- CAGCGTAAGCCTGCACCAAAAGTTAAAGAGCAAGAAGAAAAATGAGAAGTGAAGCGTATT
rJMFF022F23+ CAGCGTAAGCCTGCACCAAAAGTTAAAGAGCAAGAAGAAAAATGAGAAGTGAAGCGTATT
                      ____________________________________________________________
consensus CAGCGTAAGCCTGCACCAAAAGTTAAAGAGCAAGAAGAAAAATGAGAAGTGAAGCGTATT
 
. : . : . : . : . : . :
JMFF022F23- CCGGCAGGCTCAAGTACCCCCAGGGTGATACTTGTATTTCCTGCAGGCGCCTCTTTCTCT
rJMFF022F23+ CCGGCAGGCTCAAGTACCCCCAGGGTGATACTTGTATTTCCTGCAGGCGCCTCTTTCTCT
                      ____________________________________________________________
consensus CCGGCAGGCTCAAGTACCCCCAGGGTGATACTTGTATTTCCTGCAGGCGCCTCTTTCTCT
 
. : . : . : . : . : . :
JMFF022F23- TTGTGTTCTTAACTTTCTTTGTAATGTTAAGCACGACCACAAAACTCACCGCTGCTTCTC
rJMFF022F23+ TTGTGTTCTTAACTTTCTTTGTAATGTTAAGCACGACCACAAAACTCACCGCTGCTTCTC
                      ____________________________________________________________
consensus TTGTGTTCTTAACTTTCTTTGTAATGTTAAGCACGACCACAAAACTCACCGCTGCTTCTC
 
. : . : . : . : . : . :
JMFF022F23- TAGCCGCCGCCGCCACCGGCTCAGAATGCACAGGCACAGTCGGTGGTTGCATGGAAGCCA
rJMFF022F23+ TAGCCGCCGCCGCCACCGGCTCAGAATGCACAGGCACAGTCGGTGGTTGCATGGAAGCCA
                      ____________________________________________________________
consensus TAGCCGCCGCCGCCACCGGCTCAGAATGCACAGGCACAGTCGGTGGTTGCATGGAAGCCA
 
. : . : . : . : . : . :
JMFF022F23- TTGGGGAGGATTTCCTCATGGATTCCGAGACTACCAGAAGGCTTTTGGTCGGAAAGCAGA
rJMFF022F23+ TTGGGGAGGATTTCCTCATGGATTCCGAGACTACCAGAAGGCTTTTGGTCGGAAAGCAGA
                      ____________________________________________________________
consensus TTGGGGAGGATTTCCTCATGGATTCCGAGACTACCAGAAGGCTTTTGGTCGGAAAGCAGA
 
. : . : . : . : . : . :
JMFF022F23- GAGGTCCCATAAGTTACAACACGTTGGACAAAGGTTCAGTATGTAATGCGCACAGATACG
rJMFF022F23+ GAGGTCCCATAAGTTACAACACGTTGGACAAAGGTTCAGTATGTAATGCGCACAGATACG
                      ____________________________________________________________
consensus GAGGTCCCATAAGTTACAACACGTTGGACAAAGGTTCAGTATGTAATGCGCACAGATACG
 
. : . : . : . : . : . :
JMFF022F23- CGAGTTGCACAGGAAAGCAAAGTAACGTGAAGGTGAACTGCAACTTTCACAATAGATCGT
rJMFF022F23+ CGAGTTGCACAGGAAAGCAAAGTAACGTGAAGGTGAACTGCAACTTTCACAATAGATCGT
                      ____________________________________________________________
consensus CGAGTTGCACAGGAAAGCAAAGTAACGTGAAGGTGAACTGCAACTTTCACAATAGATCGT
 
. : . : . : . : . : . :
JMFF022F23- GTTTAAGGCCTAGATAGTGAGTGTAACTTACCTTCAATCTCTTTGTATAATTGAATGTTG
rJMFF022F23+ GTTTAAGGCCTAGATAGTGAGTGTAACTTACCTTCAATCTCTTTGTATAATTGAATGTTG
                      ____________________________________________________________
consensus GTTTAAGGCCTAGATAGTGAGTGTAACTTACCTTCAATCTCTTTGTATAATTGAATGTTG
 
. : . : . : . : . : . :
JMFF022F23- AAGTAGCTAAA
rJMFF022F23+ AAGTAGCTAAACAGTCCCGCTTGTATGTCCTCAATCTGCTAGTATTGCCTCAGACGACCC
                      ____________________________________________________________
consensus AAGTAGCTAAACAGTCCCGCTTGTATGTCCTCAATCTGCTAGTATTGCCTCAGACGACCC
 
. : . : . : . : . : . :
rJMFF022F23+ ACCTCCATTTTCAGCAATGTTGTCAATTGTGGCAATTCCGGTAGATCCGTAGATTCAAGG
                      ____________________________________________________________
consensus ACCTCCATTTTCAGCAATGTTGTCAATTGTGGCAATTCCGGTAGATCCGTAGATTCAAGG
 
. : . : . : . : . : . :
rJMFF022F23+ TTTAAACAGTGAAGGCTCTGTCTTTTCATGTTGTGTCAAAAGCTTGCAAGTGAAATATAT
                      ____________________________________________________________
consensus TTTAAACAGTGAAGGCTCTGTCTTTTCATGTTGTGTCAAAAGCTTGCAAGTGAAATATAT