Previous Contig 009251:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008C04Sequence535007079 (5)775009251 (10)gb:AP003335_18281767e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMFF022E18Sequence519007079 (5)729009251 (10)gb:AB026645_15171792e-15Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGH6.
JMFF022J04Sequence541007079 (5)695009251 (10)gb:AP003335_18281765e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMFF028F08Sequence521007079 (5)679009251 (10)pir|C86232|C862322e-41hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889986 Arabid
JMFF033P08Sequence452001516 (12)gb:AY084288_15693804e-29Arabidopsis thaliana clone 10238 mRNA, complete sequence.748009251 (10)gb:AP003335_18281749e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMSF035A07Sequence686009251 (10)gb:AP003335_18281764e-73Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114699009251 (10)gb:AP003335_18281761e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMSF036D15Sequence700007079 (5)759009251 (10)gb:AB026645_15171791e-39Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGH6.
JMSF047C07Sequence632009251 (10)gb:AB026645_15171791e-29Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGH6.587009251 (10)gb:AB026645_15171791e-29Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGH6.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035A07- GGGAATAAGTATAACAAGGAAGATTTTAGTACTG
                      ____________________________________________________________
consensus GGGAATAAGTATAACAAGGAAGATTTTAGTACTG
 
. : . : . : . : . : . :
JMSF035A07- AGTATGATTCTGCAAAATTCTATGTTATCAAGTCATACAGCGAAGATGACATTCACAAGT
                      ____________________________________________________________
consensus AGTATGATTCTGCAAAATTCTATGTTATCAAGTCATACAGCGAAGATGACATTCACAAGT
 
. : . : . : . : . : . :
JMSF035A07- CTGTCAAATATGATGTTTGGTCAAGCACTCCAAACGGCAACAAAAAATTGGAGAATGCTT
rJMFF008C04+ CAAAAAATTGGAGAATGCTT
                      ____________________________________________________________
consensus CTGTCAAATATGATGTTTGGTCAAGCACTCCAAACGGCAACAAAAAATTGGAGAATGCTT
 
. : . : . : . : . : . :
JMSF035A07- TTGGTGATGCTGAAGGAAAAGCAAGCGAGACAGGCACAGAATGCCCAGTATTCCTCTTC-
rJMFF033P08+ TGAAGGAAAAGCAAGCGAGACAGGCACAGAATGCCCAGTATTCCTCTTCT
rJMFF008C04+ TTGGTGATGCTGAAGGAAAAGCAAGCGAGACAGGCACAGAATGCCCAGTATTCCTCTTC-
                      ____________________________________________________________
consensus TTGGTGATGCTGAAGGAAAAGCAAGCGAGACAGGCACAGAATGCCCAGTATTCCTCTTC-
 
. : . : . : . : . : . :
JMSF035A07- TTTTCTGTAAA-CGGGAGT-GGACAATTTTT-GGGTGTAGCAGAGATGACAGGG-CAGGT
rJMFF033P08+ TTTTCTGTAAACCGGGAGT-GGACAATTTTT-GGGTGTAGCAGAGATGACAGGG-CAGGT
rJMFF028F08+ TAAA-CGGGAGT-GGACAATTTTT-GGGTGTAGCAGAGATGACAGGG-CAGGT
rJMFF022J04+ CTGTAAA-CGGGAGTGGGACAATTTTTGGGGTGTAGCAGAGATGACAGGGCCAGGT
rJMFF008C04+ TTTTCTGTAAA-CGGGAGT-GGACAATTTTT-GGGTGTAGCAGAGATGACAGGG-CAGGT
rJMSF035A07+ CTGTAAA-CGGGAGT-GGACAATTTTT-GGGTGTAGCAGAGATGACAGGG-CAGGT
rJMSF036D15+ GACAATTTTT-GGGTGTAGCAGAGATGACAGGG-CAGGT
                      ____________________________________________________________
consensus TTTTCTGTAAA-CGGGAGT-GGACAATTTTT-GGGTGTAGCAGAGATGACAGGG-CAGGT
 
. : . : . : . : . : . :
JMSF035A07- GGATTTTAACCAGAAAAAGGACTTTTGGCAACTCGATAAGTGGAGTGGGTTCTTCCCAGT
rJMFF033P08+ GGATTTTAACCAGAAAAAGGACTTTTGGCAACTCGATAAGTGGAGTGGGTTCTTCCCAGT
rJMFF028F08+ GGATTTTAACCAGAAAAAGGACTTTTGGCAACTCGATAAGTGGAGTGGGTTCTTCCCAGT
rJMFF022J04+ GGATTTTAACCAGAAAAAGGACTTTTGGCAACTCGATAAGTGGAGTGGGTTCTTCCCAGT
rJMFF008C04+ GGATTTTAACCAGAAAAAGGACTTTTGGCAACTCGATAAGTGGAGTGGGTTCTTCCCAGT
rJMSF035A07+ GGATTTTAACCAGAAAAAGGACTTTTGGCAACTCGATAAGTGGAGTGGGTTCTTCCCAGT
rJMSF047C07+ AGTGGAGTGGGTTCTTCCCAGT
JMSF047C07- AGTGGAGTGGGTTCTTCCCAGT
rJMSF036D15+ GGATTTTAACCAGAAAAAGGACTTTTGGCAACTCGATAAGTGGAGTGGGTTCTTCCCAGT
                      ____________________________________________________________
consensus GGATTTTAACCAGAAAAAGGACTTTTGGCAACTCGATAAGTGGAGTGGGTTCTTCCCAGT
 
. : . : . : . : . : . :
JMSF035A07- GAAGTGGCACATAGTTAAAGATGTCCCGAACACACAGTTGAGGCACATTATCCTTGAAAA
rJMFF033P08+ GAAGTGGCACATAGTTAAAGATGTCCCGAACACACAGTTGAGGCACATTATCCTTGAAAA
rJMFF028F08+ GAAGTGGCACATAGTTAAAGATGTACCGAACACACAGTTGAGGCACATTATCCTTGAAAA
rJMFF022J04+ GAAGTGGCACATAGTTAAAGATGTCCCGAACACACAGTTGAGGCACATTATCCTTGAAAA
rJMFF008C04+ GAAGTGGCACATAGTTAAAGATGTACCGAACACACAGTTGAGGCACATTATCCTTGAAAA
rJMSF035A07+ GAAGTGGCACATAGTTAAAGATGTCCCGAACACACAGTTGAGGCACATTATCCTTGAAAA
rJMSF047C07+ GAAGTGGCACATAGTTAAAGATGTCCCGAACACACAGTTGAGGCACATTATCCTTGAAAA
JMSF047C07- GAAGTGGCACATAGTTAAAGATGTCCCGAACACACAGTTGAGGCACATTATCCTTGAAAA
rJMSF036D15+ GAAGTGGCACATAGTTAAAGATGTCCCGAACACACAGTTGAGGCACATTATCCTTGAAAA
rJMFF022E18+ CCTTGAAAA
                      ____________________________________________________________
consensus GAAGTGGCACATAGTTAAAGATGTCCCGAACACACAGTTGAGGCACATTATCCTTGAAAA
 
. : . : . : . : . : . :
JMSF035A07- CAATGACAACAAGCCTGTAACTTACAGCCGAGACACTCAAGAGGTTGGATTGAAGGAAGG
rJMFF033P08+ CAATGACAACAAGCCTGTAACTTACAGCCGAGACACTCAAGAGGTTGGATTGAAGGAAGG
rJMFF028F08+ CAATGACAACAAGCCTGTAACTTACAGCCGAGACACTCAAGAGGTTGGATTGAAGGAAGG
rJMFF022J04+ CAATGACAACAAGCCTGTAACTTACAGCCGAGACACTCAAGAGGTTGGATTGAAGGAAGG
rJMFF008C04+ CAATGACAACAAGCCTGTAACTTACAGCCGAGACACTCAAGAGGTTGGATTGAAGGAAGG
rJMSF035A07+ CAATGACAACAAGCCTGTAACTTACAGCCGAGACACTCAAGAGGTTGGATTGAAGGAAGG
rJMSF047C07+ CAATGACAACAAGCCTGTAACTTACAGCCGAGACACTCAAGAGGTTGGATTGAAGGAAGG
JMSF047C07- CAATGACAACAAGCCTGTAACTTACAGCCGAGACACTCAAGAGGTTGGATTGAAGGAAGG
rJMSF036D15+ CAATGACAACAAGCCTGTAACTTACAGCCGAGACACTCAAGAGGTTGGATTGAAGGAAGG
rJMFF022E18+ CAATGACAACAAGCCTGTAACTTACAGCCGAGACACTCAAGAGGTTGGATTGAAGGAAGG
                      ____________________________________________________________
consensus CAATGACAACAAGCCTGTAACTTACAGCCGAGACACTCAAGAGGTTGGATTGAAGGAAGG
 
. : . : . : . : . : . :
JMSF035A07- CTTGGAAATGCTTAACATCTTCAAGTCTTACTCCGAGAAGTCCTCACTGTTGGATGACTT
rJMFF033P08+ CTTGGAAATGCTTAACATCTTCAAGTCTTACTCCGAGAAGTCCTCACTGTTGGATGACTT
rJMFF028F08+ CTTGGAAATGCTTAACATCTTCAAGTCTTACTCCGAGAAGTCCTCACTGTTGGATGACTT
rJMFF022J04+ CTTGGAAATGCTTAACATCTTCAAGTCTTACTCCGAGAAGTCCTCACTGTTGGATGACTT
rJMFF008C04+ CTTGGAAATGCTTAACATCTTCAAGTCTTACTCCGAGAAGTCCTCACTGTTGGATGACTT
rJMSF035A07+ CTTGGAAATGCTTAACATCTTCAAGTCTTACTCCGAGAAGTCCTCACTGTTGGATGACTT
rJMSF047C07+ CTTGGAAATGCTTAACATCTTCAAGTCTTACTCCGAGAAGTCCTCACTGTTGGATGACTT
JMSF047C07- CTTGGAAATGCTTAACATCTTCAAGTCTTACTCCGAGAAGTCCTCACTGTTGGATGACTT
rJMSF036D15+ CTTGGAAATGCTTAACATCTTCAAGTCTTACTCCGAGAAGTCCTCACTGTTGGATGACTT
rJMFF022E18+ CTTGGAAATGCTTAACATCTTCAAGTCTTACTCCGAGAAGTCCTCACTGTTGGATGACTT
                      ____________________________________________________________
consensus CTTGGAAATGCTTAACATCTTCAAGTCTTACTCCGAGAAGTCCTCACTGTTGGATGACTT
 
. : . : . : . : . : . :
JMSF035A07- TGACTTCTATGAGGATAGAGAAAATTTGATTAAGGCCAGCAGGAGTTTTAAGACAGGATC
rJMFF033P08+ TGACTTCTATGAGGATAGAGAAAATTTGATTAAGGCCAGCAGGAGTTTTAAGACAGGATC
rJMFF028F08+ TGACTTCTATGAGGATAGAGAAAATTTGATTAAGGCCAGCAGGAGTTTTAAGACAGGATC
rJMFF022J04+ TGACTTCTATGAGGATAGAGAAAATTTGATTAAGGCCAGCAGGAGTTTTAAGACAGGATC
rJMFF008C04+ TGACTTCTATGAGGATAGAGAAAATTTGATTAAGGCCAGCAGGAGTTTTAAGACAGGATC
rJMSF035A07+ TGACTTCTATGAGGATAGAGAAAATTTGATTAAGGCCAGCAGGAGTTTTAAGACAGGATC
rJMSF047C07+ TGACTTCTATGAGGATAGAGAAAATTTGATTAAGGCCAGCAGGAGTTTTAAGACAGGATC
JMSF047C07- TGACTTCTATGAGGATAGAGAAAATTTGATTAAGGCCAGCAGGAGTTTTAAGACAGGATC
rJMSF036D15+ TGACTTCTATGAGGATAGAGAAAATTTGATTAAGGCCAGCAGGAGTTTTAAGACAGGATC
rJMFF022E18+ TGACTTCTATGAGGATAGAGAAAATTTGATTAAGGCCAGCAGGAGTTTTAAGACAGGATC
                      ____________________________________________________________
consensus TGACTTCTATGAGGATAGAGAAAATTTGATTAAGGCCAGCAGGAGTTTTAAGACAGGATC
 
. : . : . : . : . : . :
JMSF035A07- TGAAGCAGGTGCATTCCAGAATCGGGACCCTCATAAGCAATTCAATGAAGGGGAAAAGGA
rJMFF033P08+ TGAAGCAGGTGCATTCCAGAATCGGGACCCTCATAAGCAATTCAATGAAGGGGAAAAGGA
rJMFF028F08+ TGAAGCAGGTGCATTCCAGAATCGGGACCCTCATAAGCAATTCAATGAAGGGGAAAAGGA
rJMFF022J04+ TGAAGCAGGTGCATTCCAGAATCGGGACCCTCATAAGCAATTCAATGAAGGGGAAAAGGA
rJMFF008C04+ TGAAGCAGGTGCATTCCAGAATCGGGACCCTCATAAGCAATTCAATGAAGGGGAAAAGGA
rJMSF035A07+ TGAAGCAGGTGCATTCCAGAATCGGGACCCTCATAAGCAATTCAATGAAGGGGAAAAGGA
rJMSF047C07+ TGAAGCAGGTGCATTCCAGAATCGGGACCCTCATAAGCAATTCAATGAAGGGGAAAAGGA
JMSF047C07- TGAAGCAGGTGCATTCCAGAATCGGGACCCTCATAAGCAATTCAATGAAGGGGAAAAGGA
rJMSF036D15+ TGAAGCAGGTGCATTCCAGAATCGGGACCCTCATAAGCAATTCAATGAAGGGGAAAAGGA
rJMFF022E18+ TGAAGCAGGTGCATTCCAGAATCGGGACCCTCATAAGCAATTCAATGAAGGGGAAAAGGA
                      ____________________________________________________________
consensus TGAAGCAGGTGCATTCCAGAATCGGGACCCTCATAAGCAATTCAATGAAGGGGAAAAGGA
 
. : . : . : . : . : . :
JMSF035A07- AAACGAGGAAAAATCGTTGGAAACTGGTATTACTGATTCTGCTTCCTCTCTCATTGG
rJMFF033P08+ AAACGAGGAAAAATCGTTGGAAACTGGTATTACTGATTCTGCTTCCTCTCTCATTGGTCT
rJMFF028F08+ AAACGAGGAAAAATCGTTGAAAACTGGTATTACTGATTCTGCTTCCTCTCTCATTGGTCT
rJMFF022J04+ AAACGAGGAAAAATCGTTGGAAACTGGTATTACTGATTCTGCTTCCTCTCTCATTGGTCT
rJMFF008C04+ AAACGAGGAAAAATCGTTGAAAACTGGTATTACTGATTCTGCTTCCTCTCTCATTGGTCT
rJMSF035A07+ AAACGAGGAAAAATCGTTGGAAACTGGTATTACTGATTCTGCTTCCTCTCTCATTGGTCT
rJMSF047C07+ AAACGAGGAAAAATCGTTGGAAACTGGTATTACTGATTCTGCTTCCTCTCTCATTGGTCT
JMSF047C07- AAACGAGGAAAAATCGTTGGAAACTGGTATTACTGATTCTGCTTCCTCTCTCATTGGTCT
rJMSF036D15+ AAACGAGGAAAAATCGTTGGAAACTGGTATTACTGATTCTGCTTCCTCTCTCATTGGTCT
rJMFF022E18+ AAACGAGGAAAAATCGTTGGAAACTGGTATTACTGATTCTGCTTCCTCTCTCATTGGTCT
                      ____________________________________________________________
consensus AAACGAGGAAAAATCGTTGGAAACTGGTATTACTGATTCTGCTTCCTCTCTCATTGGTCT
 
. : . : . : . : . : . :
rJMFF033P08+ CACCGAAAACCTTTCTGTAAACGCCTAATGAATCAACCGGAGAATGTGGTGGCTTGAAGG
rJMFF028F08+ CACCGAAAACCTTTCTGTAAACGCCTAATGAATCAACCGGAGAATGTGGTGGCTTGAAGG
rJMFF022J04+ CACCGAAAACCTTTCTGTAAACGCCTAATGAATCAACCGGAGAATGTGGTGGCTTGAAGG
rJMFF008C04+ CACCGAAAACCTTTCTGTAAACGCCTAATGAATCAACCGGAGAATGTGGTGGCTTGAAGG
rJMSF035A07+ CACCGAAAACCTTTCTGTAAACGCCTAATGAATCAACCGGAGAATGTGGTGGCTTGAAGG
rJMSF047C07+ CACCGAAAACCTTTCTGTAAACGCCTAATGAATCAACCGGAGAATGTGGTGGCTTGAAGG
JMSF047C07- CACCGAAAACCTTTCTGTAAACGCCTAATGAATCAACCGGAGAATGTGGTGGCTTGAAGG
rJMSF036D15+ CACCGAAAACCTTTCTGTAAACGCCTAATGAATCAACCGGAGAATGTGGTGGCTTGAAGG
rJMFF022E18+ CACCGAAAACCTTTCTGTAAACGCCTAATGAATCAACCGGAGAATGTGGTGGCTTGAAGG
                      ____________________________________________________________
consensus CACCGAAAACCTTTCTGTAAACGCCTAATGAATCAACCGGAGAATGTGGTGGCTTGAAGG
 
. : . : . : . : . : . :
rJMFF033P08+ GGGACTCAAGTTGGGGTGAACTGCACCATTTCTTGTGTTGTTGTTCAGTTTTATGAATTA
rJMFF028F08+ GGGACTCAAGTTGGGGTGAACTGCACCATTTCTTGTGTTGTTGTTCAGTTTTATGAATTA
rJMFF022J04+ GGGACTCAAGTTGGGGTGAACTGCACCATTTCTTGTGTTGTTGTTCAGTTTTATGAATTA
rJMFF008C04+ GGGACTCAAGTTGGGGTGAACTGCACCATTTCTTGTGTTGTTGTTCAGTTTTATGAATTA
rJMSF035A07+ GGGACTCAAGTTGGGGTGAACTGCACCATTTCTTGTGTTGTTGTTCAGTTTTATGAATTA
rJMSF047C07+ GGGACTCAAGTTGGGGTGAACTGCACCATTTCTTGTGTTGTTGTTCAGTTTTATGAATTA
JMSF047C07- GGGACTCAAGTTGGGGTGAACTGCACCATTTCTTGTGTTGTTGTTCAGTTTTATGAATTA
rJMSF036D15+ GGGACTCAAGTTGGGGTGAACTGCACCATTTCTTGTGTTGTTGTTCAGTTTTATGAATTA
rJMFF022E18+ GGGACTCAAGTTGGGGTGAACTGCACCATTTCTTGTGTTGTTGTTCAGTTTTATGAATTA
                      ____________________________________________________________
consensus GGGACTCAAGTTGGGGTGAACTGCACCATTTCTTGTGTTGTTGTTCAGTTTTATGAATTA
 
. : . : . : . : . : . :
rJMFF033P08+ CCATGTTTCTGTTTGTTGTTATTTTATCAGTTTAGCCATGTTTNTGGGTTGGTGTTCCTT
rJMFF028F08+ CCATGTTTCTGTTTGTTGTTATTTTATCAGTTTAGCCATGTTTCTGGGTTGGTGTTCCTT
rJMFF022J04+ CCATGTTTCTGTTTGCTGTTATTTTATCAGTTTAGCCATGTTTCTGGGTTGGTGTTCCTT
rJMFF008C04+ CCATGTTTCTGTTTGTTGTTATTTTATCAGTTTAGCCATGTTTCTGGGTTGGTGTTCCTT
rJMSF035A07+ CCATGTTTCTGTTTGTTGTTATTTTATCAGTTTAGCCATGTTTCTGGGTTGGTGTTCCTT
rJMSF047C07+ CCATGTTTCTGTTTGTTGTTATTTTATCAGTTTAGCCATGTTTCTGGGTTGGTGTTCCTT
JMSF047C07- CCATGTTTCTGTTTGTTGTTATTTTATCAGTTTAGCCATGTTTCTGGGTTGGTGTTCCTT
rJMSF036D15+ CCATGTTTCTGTTTGTTGTTATTTTATCAGTTTAGCCATGTTTCTGGGTTGGTGTTCCTT
rJMFF022E18+ CCATGTTTCTGTTTGTTGTTATTTTATCAGTTTAGCCATGTTTCTGGGTTGGTGTTCCTT
                      ____________________________________________________________
consensus CCATGTTTCTGTTTGTTGTTATTTTATCAGTTTAGCCATGTTTCTGGGTTGGTGTTCCTT
 
. : . : . : . : . : . :
rJMFF033P08+ TCCAACCCTTTAAGAAGAAAGAAATGCAA
rJMFF028F08+ TCCAACCCTTTAAGAAGAAAGAAATGCAAT
rJMFF022J04+ TCCAACCCTTTAAGAAGAAAGAAATGCAATTTAGTTAAT
rJMFF008C04+ TCCAACCCTTTAAGAAGAAAGAAATGCAATTTAGTTAATG
rJMSF035A07+ TCCAACCCTTTAAGAAGAAAGAAATGCAATTTAGTTAATGTTGT
rJMSF047C07+ TCCAACCCTTTAAGAAGAAAGAAAT
JMSF047C07- TCCAACCCTTTAAGAAGAAAGAAATGCAATTTAGTTAATGTTGTTGTTGTCTGGTTTGCT
rJMSF036D15+ TCCAACCCTTTAAGAAGAAAGAAATGCAATTTAGTTAATGTTGTTGTTGTCTGGTTTGCT
rJMFF022E18+ TCCAACCCTTTAAGAAGAAAGAAATGCAATTTAGTTAATGTTGTTGTTGTCTGGTTTGCT
                      ____________________________________________________________
consensus TCCAACCCTTTAAGAAGAAAGAAATGCAATTTAGTTAATGTTGTTGTTGTCTGGTTTGCT
 
. : . : . : . : . : . :
JMSF047C07- A
rJMSF036D15+ ATCAAGTTTTTTATCTTCTTCATTTTGTTCATTTGATAGCCATGTTTATTGTTTTCTCCA
rJMFF022E18+ ATCAAGTTTTTTATCTTCTTCATTTTGTTCATTTGATAGCCATGTTTATTGTTTTCTCCA
                      ____________________________________________________________
consensus ATCAAGTTTTTTATCTTCTTCATTTTGTTCATTTGATAGCCATGTTTATTGTTTTCTCCA
 
. : . : . : . : . : . :
rJMSF036D15+ TT
rJMFF022E18+ TTTGTGTCTGCAAATCCACAATGAAGGCCAAGACATGCCTTTTCTATTTTGGGTGTACCC
                      ____________________________________________________________
consensus TTTGTGTCTGCAAATCCACAATGAAGGCCAAGACATGCCTTTTCTATTTTGGGTGTACCC
 
. : . : . : . : . : . :
rJMFF022E18+ AGAGTTTTTACTGTCGGATACTGTCTAATTCCTTCACTGAATTGTAGTTACCTTTTCGAG
                      ____________________________________________________________
consensus AGAGTTTTTACTGTCGGATACTGTCTAATTCCTTCACTGAATTGTAGTTACCTTTTCGAG