Previous Contig 009227:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021L12Sequence431001089 (3)gb:AF181687_17748623e-25Arabidopsis thaliana metal ion transporter (PMIT1) mRNA, complete cds.613009227 (3)gb:BT020428_16428235e-43Arabidopsis thaliana At1g15960 mRNA, complete cds.
JMSF020F19Sequence723001089 (3)sp|Q9S9N8|NRM6_ARATH4e-71Metal transporter Nramp6 (AtNramp6).>gb:ATH291831_1552317 Arabidopsis thaliana m740009227 (3)gb:BT020428_16428232e-59Arabidopsis thaliana At1g15960 mRNA, complete cds.
JMSF032C10Sequence697001089 (3)sp|Q9S9N8|NRM6_ARATH4e-67Metal transporter Nramp6 (AtNramp6).>gb:ATH291831_1552317 Arabidopsis thaliana m770009227 (3)gb:BT020428_16428232e-56Arabidopsis thaliana At1g15960 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032C10+ AGTTCC
                      ____________________________________________________________
consensus AGTTCC
 
. : . : . : . : . : . :
rJMSF020F19+ ATTGCGTTGCTAGCATCAGGACAGAGTTCTACCATAACGGGGACTTAC
rJMSF032C10+ NAGCTCTTTGCGATTGCGTTGCTAGCATCAGGACAGAGTTCTACCATAACGGGGACTTAC
                      ____________________________________________________________
consensus NAGCTCTTTGCGATTGCGTTGCTAGCATCAGGACAGAGTTCTACCATAACGGGGACTTAC
 
. : . : . : . : . : . :
rJMSF020F19+ GCTGGGCAATACGTTATGCAGGGTTTTCTTGATTTAAGGTTGAAGCCTTGGATTAGGAAC
rJMSF032C10+ GCTGGGCAATACGTTATGCAGGGTTTTCTTGATTTAAGGTTGAAGCCTTGGATTAGGAAC
                      ____________________________________________________________
consensus GCTGGGCAATACGTTATGCAGGGTTTTCTTGATTTAAGGTTGAAGCCTTGGATTAGGAAC
 
. : . : . : . : . : . :
rJMSF020F19+ ATGCTTACTCGGGGCTTAGCCATCGTTCCAAGTCTAATTGTTTCAATTATCGGTGGCTCT
rJMSF032C10+ ATGCTTACTCGGGGCTTAGCCATCGTTCCAAGTCTAATTGTTTCAATTATCGGTGGCTCT
rJMFF021L12+ TATCTGTGGCTCT
                      ____________________________________________________________
consensus ATGCTTACTCGGGGCTTAGCCATCGTTCCAAGTCTAATTGTTTCAATTATCGGTGGCTCT
 
. : . : . : . : . : . :
rJMSF020F19+ GCTGGGGCTGGAAATTTAATCATTATTGCATCGATGATCTTATCATTTGAACTCCCCTTT
rJMSF032C10+ GCTGGGGCTGGAAATTTAATCATTATTGCATCGATGATCTTATCATTTGAACTCCCCTTT
rJMFF021L12+ GCTGGGGCTGGAAATTTAATCATTATTGCATCGATGATCTTATCATTTGAACTCCCCTTT
                      ____________________________________________________________
consensus GCTGGGGCTGGAAATTTAATCATTATTGCATCGATGATCTTATCATTTGAACTCCCCTTT
 
. : . : . : . : . : . :
rJMSF020F19+ GCTCTCATTCCGTTGCTCAAATTCACGAGCAGCAAAACCAAGATGGGTGTACACGCCAAC
rJMSF032C10+ GCTCTCATTCCGTTGCTCAAATTCACGAGCAGCAAAACCAAGATGGGTGTACACGCCAAC
rJMFF021L12+ GCTCTCATTCCGTTGCTCAAATTCACGAGCAGCAAAACCAAGATGGGTGTACACGCCAAC
                      ____________________________________________________________
consensus GCTCTCATTCCGTTGCTCAAATTCACGAGCAGCAAAACCAAGATGGGTGTACACGCCAAC
 
. : . : . : . : . : . :
rJMSF020F19+ TCAAAAATAATTTCTGCGATCACTTGGATAATCGGGTCATTGATCATGGGAATCAACATC
rJMSF032C10+ TCAAAAATAATTTCTGCGATCACTTGGATAATCGGGTCATTGATCATGGGAATCAACATC
rJMFF021L12+ TCAAAAATAATTTCTGCGATCACTTGGATAATCGGGTCATTGATCATGGGAATCAACATC
                      ____________________________________________________________
consensus TCAAAAATAATTTCTGCGATCACTTGGATAATCGGGTCATTGATCATGGGAATCAACATC
 
. : . : . : . : . : . :
rJMSF020F19+ TATTACCTTGCAGAGAAGTTAGTTACTTCCCTCAAGAACAGTGATTTGAAGATGGTGGGC
rJMSF032C10+ TATTACCTTGCAGAGAAGTTAGTTACTTCCCTCAAGAACAGTGATTTGAAGATGGTGGGC
rJMFF021L12+ TATTACCTTGCAGAGAAGTTAGTTACTTCCCTCAAGAACAGTGATTTGAAGATGGTGGGC
                      ____________________________________________________________
consensus TATTACCTTGCAGAGAAGTTAGTTACTTCCCTCAAGAACAGTGATTTGAAGATGGTGGGC
 
. : . : . : . : . : . :
rJMSF020F19+ AAGGTGTTGTGTGGAATCTTGGGGTTCACGGGATTGTTGGTCTACTTGGGAAGCATCGCA
rJMSF032C10+ AAGGTGTTGTGTGGAATCTTGGGGTTCACGGGATTGTTGGTCTACTTGGGAAGCATCGCA
rJMFF021L12+ AAGGTGTTGTGTGGAATCTTGGGGTTCACGGGATTGTTGGTCTACTTGGGAAGCATCGCA
                      ____________________________________________________________
consensus AAGGTGTTGTGTGGAATCTTGGGGTTCACGGGATTGTTGGTCTACTTGGGAAGCATCGCA
 
. : . : . : . : . : . :
rJMSF020F19+ TACCTAGTCATCCGAAAAAACAAGGAACGCACCCACCTTCTCGCACTCGCTGCCGTCGAT
rJMSF032C10+ TACCTAGTCATCCGAAAAAACAAGGAACGCACCCACCTTCTCGCACTCGCTGCCGTCGAT
rJMFF021L12+ TACCTAGTCATCCGAAAAAACAAGGAACGCACCCACCTTCTCGCACTCGCTGCCGTCGAT
                      ____________________________________________________________
consensus TACCTAGTCATCCGAAAAAACAAGGAACGCACCCACCTTCTCGCACTCGCTGCCGTCGAT
 
. : . : . : . : . : . :
rJMSF020F19+ GGGTCACCAAACGGCAACGAGCCAAGTCTACCCCGAGAGGACATTCGGAGCATGCAACTG
rJMSF032C10+ GGGTCACCAAACGGCAACGAGCCAAGTCTACCCCGAGAGGACATTCGGAGCATGCAACTG
rJMFF021L12+ GGGTCACCAAACGGCAACGAGCCAAGTCTACCCCGAGAGGACATTCGGAGCATGCAACTG
                      ____________________________________________________________
consensus GGGTCACCAAACGGCAACGAGCCAAGTCTACCCCGAGAGGACATTCGGAGCATGCAACTG
 
. : . : . : . : . : . :
rJMSF020F19+ CCGGAGAAGAGGTCTACTTTAGATGTGGAGTGAAGGAGTGATAGTATAGGTCGGAAGATA
rJMSF032C10+ CCGGAGAAGAGGTCTACTTTAGATGTGGAGTGAAGGAGTGATAGTATAGGTCGGAAGATA
rJMFF021L12+ CCGGAGAAGAGGTCTACTTTAGATGTGGAGTGAAGGAGTGATAGTATAGGTCGGAAGATA
                      ____________________________________________________________
consensus CCGGAGAAGAGGTCTACTTTAGATGTGGAGTGAAGGAGTGATAGTATAGGTCGGAAGATA
 
. : . : . : . : . : . :
rJMSF020F19+ TAAATGACAACCTAACTAGGTGGAAATACAGGTAGCAACATGGATAGTGGTTGGTGTTTT
rJMSF032C10+ TAAATGACAACCTAACTAGGTGGAAATAGAGGTAGCAACATGGATAGTGGTTGGTGTTTT
rJMFF021L12+ TAAATGACAACCTAACTAGGTGGAAATAGAGGTAGCAACATGGATAGTGGTTGGTGTTTT
                      ____________________________________________________________
consensus TAAATGACAACCTAACTAGGTGGAAATAGAGGTAGCAACATGGATAGTGGTTGGTGTTTT
 
. : . : . : . : . : . :
rJMSF020F19+ CTTTCCATTTTGATGTTAAGGTTTTAGATATC
rJMSF032C10+ CTTTCCATTTTGATGTTAAGGTTTTAGATATC
rJMFF021L12+ CTTTCCATTTTGATGTTAAGGTTTTAGATATCATAAGCTGTACGTGTGTGACGTGCTATT
                      ____________________________________________________________
consensus CTTTCCATTTTGATGTTAAGGTTTTAGATATCATAAGCTGTACGTGTGTGACGTGCTATT