Previous Contig 009223:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001I20Sequence583009223 (10)gb:AB005243_15095422e-46Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRN17.>gb:AY054614_1563724009223 (10)gb:AF083749_17669791e-61Arabidopsis thaliana clone sps517 unknown mRNA.
JMFF021J03Sequence583009223 (10)gb:AB005243_15095422e-46Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRN17.>gb:AY054614_1563692009223 (10)gb:AF083749_17669795e-51Arabidopsis thaliana clone sps517 unknown mRNA.
JMFF032O03Sequence173009223 (10)gb:AB005243_15095421e-05Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRN17.>gb:AY054614_1563759009223 (10)gb:AF083749_17669796e-61Arabidopsis thaliana clone sps517 unknown mRNA.
JMFF036M15Sequence554009223 (10)gb:AB005243_15095425e-42Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRN17.>gb:AY054614_1563752009223 (10)gb:AF083749_17669797e-67Arabidopsis thaliana clone sps517 unknown mRNA.
JMSF014H17Sequence489009223 (10)gb:AB005243_15095422e-36Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRN17.>gb:AY054614_1563818009223 (10)gb:AB005243_15095422e-74Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRN17.>gb:AY054614_1563

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF021J03- GTATAACTTTAACACCGA
JMFF001I20- AACTTTAACACCGA
                      ____________________________________________________________
consensus GTATAACTTTAACACCGA
 
. : . : . : . : . : . :
JMSF014H17- AGCAACTAAACCGAAACTTCCCATCTCGCTGCGGTTCC
JMFF021J03- TTTGGAAGTCGACCTGTTGGACAGCAACTAAACCGAAACTTCCCATCTCGCTGCGGTTCC
JMFF001I20- TTTGGAAGTCGACCTGTTGGACAGCAACTAAACCGAAACTTCCCATCTCGCTGCGGTTCC
JMFF036M15- AGCAACTAAACCGAAACTTCCCATCTCGCTGCGGTTCC
                      ____________________________________________________________
consensus TTTGGAAGTCGACCTGTTGGACAGCAACTAAACCGAAACTTCCCATCTCGCTGCGGTTCC
 
. : . : . : . : . : . :
JMSF014H17- GATCTATCGTCTTCTTCGTCGTCGGGTAAATTAGGTGCCGTCAAATAGTAAAATCACTCA
JMFF021J03- GATCTATCGTCTTCTTCGTCGTCGGGTAAATTAGGTGCCGTCAAATAGTAAAATCACTCA
JMFF001I20- GATCTATCGTCTTCTTCGTCGTCGGGTAAATTAGGTGCCGTCAAATAGTAAAATCACTCA
JMFF036M15- GATCTATCGTCTTCTTCGTCGTCGGGTAAATTAGGTGCCGTCAAATAGTAAAATCACTCA
                      ____________________________________________________________
consensus GATCTATCGTCTTCTTCGTCGTCGGGTAAATTAGGTGCCGTCAAATAGTAAAATCACTCA
 
. : . : . : . : . : . :
JMSF014H17- AAAGAAAAAACCACGCAATCTCGATCGCTCTCTCTCGTCTTTTGAGTGGTTTTAGAGTTT
JMFF021J03- AAAGAAAAAACCACGCAATCTCGATCGCTCTCTCTCGTCTTTTGAGTGGTTTTAGAGTTT
JMFF032O03- GTCTTTTGAGTGGTTTTAGAGTTT
JMFF001I20- AAAGAAAAAACCACGCAATTTCGATCGCTCTCTCTCGTCTTTTGAGTGGTTTTAGAGTTT
JMFF036M15- AAAGAAAAAACCACGCAGTCTCGATCGCTCTCTCTCGTCTTTTGAGTGGTTTTAGAGTTT
                      ____________________________________________________________
consensus AAAGAAAAAACCACGCAATCTCGATCGCTCTCTCTCGTCTTTTGAGTGGTTTTAGAGTTT
 
. : . : . : . : . : . :
JMSF014H17- TATCACTTGAAATTAAGGGAGATGGAAAAAGTGATGAATATATTGAAGCCGAAGGCAAAC
JMFF021J03- TATCACTTGAAATTAAGGGAGATGGAAAAAGTGATGAATATATTGAAGCCGAAGGCAAAC
JMFF032O03- TATCACTTGAAATTAAGGGAGATGGAAAAAGTGATGAATATATTGAAGCCGAAGGCAAAC
JMFF001I20- TATCACTTGAAATTAAGGGAGATGGAAAAAGTGATGAATATATTGAAGCCGAAGGCAAAC
JMFF036M15- TATCACTTGAAATTAAGGGAGATGGAAAAAGTGATGAATATATTGAAGCCGAAGGCAAAC
rJMSF014H17+ GGAGATGGAAAAAGTGATGAATATATTGAAGCCGAAGGCAAAC
                      ____________________________________________________________
consensus TATCACTTGAAATTAAGGGAGATGGAAAAAGTGATGAATATATTGAAGCCGAAGGCAAAC
 
. : . : . : . : . : . :
JMSF014H17- CCTCAACAGCTTTTGAGGGATTGGCAGCGCCGCCTTCGCCAAGAGTGTCGCAACATCGAA
JMFF021J03- CCTCAACAGCTTTTGAGGGATTGGCAGCGCCGCCTTCGCCAAGAGTGTCGCAACATCGAA
JMFF032O03- CCTCAACAGCTTTTGAGGGATTGGCAGCGCCGCCTTCGCCAAGAGTGTCGCAACATCGAA
JMFF001I20- CCTCAACAGCTTTTGAGGGATTGGCAGCGCCGCCTTCGCCAAGAGTGTCGCAACATCGAA
JMFF036M15- CCTCAACAGCTTTTGAGGGATTGGCAGCGCCGCCTTCGCCAAGAGTGTCGCAACATCGAA
rJMSF014H17+ CCTCAACAGCTTTTGAGGGATTGGCAGCGCCGCCTTCGCCAAGAGTGTCGCAACATCGAA
rJMFF036M15+ GAGTGTCGCAACATCGAA
                      ____________________________________________________________
consensus CCTCAACAGCTTTTGAGGGATTGGCAGCGCCGCCTTCGCCAAGAGTGTCGCAACATCGAA
 
. : . : . : . : . : . :
JMSF014H17- CGCCAAATCCGAGATATACAGAGAGAAGAAAAGAATGTACAGAAAGCAATTAAAGAAGCT
JMFF021J03- CGCCAAATCCGAGATATACAGAGAGAAGAAAAGAATGTACAGAAAGCAATTAAAGAAGCT
JMFF032O03- CGCCAAATCCGAGATATACAGAGAGAAGA
JMFF001I20- CGCCAAATCCGAGATATACAGAGAGAAGAAAAGAATGTACAGAAAGCAATTAAAGAAGCT
JMFF036M15- CGCCAAATCCGAGATATACAGAGAGAAGAAAAGAATGTACAGAAAGCAATTAAAGAAGCT
rJMSF014H17+ CGCCAAATCCGAGATATACAGAGAGAAGAAAAGAATGTACAGAAAGCAATTAAAGAAGCT
rJMFF036M15+ CGCCAAATCCGAGATATACAGAGAGAAGAAAAGAATGTACAGAAAGCAATTAAAGAAGCT
rJMFF001I20+ CAGAGAGANGAAAAGAATGTNCAGAAAGCAATTAAAGAAGCT
rJMFF032O03+ AGAGAGANGAAAAGAATGTNCAGAAAGCAATTAAAGAAGCT
                      ____________________________________________________________
consensus CGCCAAATCCGAGATATACAGAGAGAAGAAAAGAATGTACAGAAAGCAATTAAAGAAGCT
 
. : . : . : . : . : . :
JMSF014H17- GCCAAGAGAAACGATATGGGTTCTGCTAAGGCACTTGCTAAAGAGCTTGTAAGATCTAGA
JMFF021J03- GCCAAGAGAAACGATATGGGTTCTGCTAAGGCACTTGCTAAAGAGCTTGTAAGATCTAGA
JMFF001I20- GCCAAGAGAAACGATATGGGTTCTGCTAAGGCACTTGCTAAAGAGCTTGTAAGATCTAGA
JMFF036M15- GCCAAGAGAAACGATATGGGTTCTGCTAAGGCACTTGCTAAAGAGCTTGTAAGATCTAGA
rJMSF014H17+ GCCAAGAGAAACGATATGGGTTCTGCTAAGGCACTTGCTAAAGAGCTTGTAAGATCTAGA
rJMFF036M15+ GCCAAGAGAAACGATATGGGTTCTGCTAAGGCACTTGCTAAAGAGCTTGTAAGATCTAGA
rJMFF001I20+ GCCAAGAGAAACGATATGGGTTCTGCTAAGGCACTTGCTAAAGAGCTTGTAAGATCTAGA
rJMFF032O03+ GCCAAGAGAAACGATATGGGTTCTGCTAAGGCACTTGCTAAAGAGCTTGTAAGATCTAGA
rJMFF021J03+ AAGGCACTTGCTAAAGAGCTTGTAAGATCTAGA
                      ____________________________________________________________
consensus GCCAAGAGAAACGATATGGGTTCTGCTAAGGCACTTGCTAAAGAGCTTGTAAGATCTAGA
 
. : . : . : . : . : . :
JMSF014H17- AAAACTGTCAACAGGCTGTATGAAAATAAGGCACAGTTGAATTCAATATCCATGCACCTC
JMFF021J03- AAAACTGTCAACAGGCTGTATGAAAATAAGGCACAGTTGAATTCAATATCCATGCACCTC
JMFF001I20- AAAACTGTCAACAGGCTGTATGAAAATAAGGCACAGTTGAATTCAATATCCATGCACCTC
JMFF036M15- AAAACTGTCAACAGGCTGTATGAAAATAAGGCACAGTTGAATTCAATATCCATGCACCTC
rJMSF014H17+ AAAACTGTCAACAGGCTGTATGAAAATAAGGCACAGTTGAATTCAATATCCATGCACCTC
rJMFF036M15+ AAAACTGTCAACAGGCTGTATGAAAATAAGGCACAGTTGAATTCAATATCCATGCACCTC
rJMFF001I20+ AAAACTGTCAACAGGCTGTATGAAAATAAGGCACAGTTGAATTCAATATCCATGCACCTC
rJMFF032O03+ AAAACTGTCAACAGGCTGTATGAAAATAAGGCACAGTTGAATTCAATATCCATGCACCTC
rJMFF021J03+ AAAACTGTCAACAGGCTGTATGAAAATAAGGCACAGTTGAATTCAATATCCATGCACCTC
                      ____________________________________________________________
consensus AAAACTGTCAACAGGCTGTATGAAAATAAGGCACAGTTGAATTCAATATCCATGCACCTC
 
. : . : . : . : . : . :
JMSF014H17- GGAGAAAGTGTTGCCATTGCTCGCACAGTA
JMFF021J03- GGAGAAAGTGTTGCCATTGCTCGCACAGTAGGACATTTGTCCAAG-AGTGCTGAAGTCAT
JMFF001I20- GGAGAAAGTGTTGCCATTGCTCGCACAGTAGGACATTTGTCCAAG-AGTGCTGAAGTCAT
JMFF036M15- GGAGAAAGTGTTGCCATTGCTCGCACAGTAGGACATTTGTCCAAGAAGTGCTGAAGTCAT
rJMSF014H17+ GGAGAAAGTGTTGCCATTGCTCGCACAGTAGGACATTTGTCCAAG-AGTGCTGAAGTCAT
rJMFF036M15+ GGAGAAAGTGTTGCCATTGCTCGCACAGTAGGACATTTGTCCAAG-AGTGCTGAAGTCAT
rJMFF001I20+ GGAGAAAGTGTTGCCATTGCTCGCACAGTAGGACATTTGTCCAAG-AGTGCTGAAGTCAT
rJMFF032O03+ GGAGAAAGTGTTGCCATTGCTCGCACAGTAGGACATTTGTCCAAG-AGTGCTGAAGTCAT
rJMFF021J03+ GGAGAAAGTGTTGCCATTGCTCGCACAGTAGGACATTTGTCCAAG-AGTGCTGAAGTCAT
                      ____________________________________________________________
consensus GGAGAAAGTGTTGCCATTGCTCGCACAGTAGGACATTTGTCCAAG-AGTGCTGAAGTCAT
 
. : . : . : . : . : . :
JMFF021J03- GAAGCTTGTCAATAATCTTATGAAGG
JMFF001I20- GAAGCTTGTCAATAATCTTATGAAGGC
JMFF036M15- GAAGCTTGTCAATAATCTTATGAAGGCCC
rJMSF014H17+ GAAGCTTGTCAATAATCTTATGAAGGCCCCAGAAGTGGCTCGAACAATGCAAGAGTTCAG
rJMFF036M15+ GAAGCTTGTCAATAATCTTATGAAGGCCCCAGAAGTGGCTCGAACAATGCAAGAGTTCAG
rJMFF001I20+ GAAGCTTGTCAATAATCTTATGAAGGCCCCAGAAGTGGCTCGAACAATGCAAGAGTTCAG
rJMFF032O03+ GAAGCTTGTCAATAATCTTATGAAGGCCCCAGAAGTGGCTCGAACAATGCAAGAGTTCAG
rJMFF021J03+ GAAGCTTGTCAATAATCTTATGAAGGCCCCAGAAGTGGCTCGAACAATGCAAGAGTTCAG
                      ____________________________________________________________
consensus GAAGCTTGTCAATAATCTTATGAAGGCCCCAGAAGTGGCTCGAACAATGCAAGAGTTCAG
 
. : . : . : . : . : . :
rJMSF014H17+ TAAAGAAATGACCAAGGCTGGTGTTATTGAAGAGATGATGAATGATGCCGTGGACAATGC
rJMFF036M15+ TAAAGAAATGACCAAGGCTGGTGTTATTGAAGAGATGATGAATGATGCCGTGGACAATGC
rJMFF001I20+ TAAAGAAATGACCAAGGCTGGTGTTATTGAAGAGATGATGAATGATGCCGTGGACAATGC
rJMFF032O03+ TAAAGAAATGACCAAGGCTGGTGTTATTGAAGAGATGATGAATGATGCCGTGGACAATGC
rJMFF021J03+ TAAAGAAATGACCAAGGCTGGTGTTATTGAAGAGATGATGAATGATGCCGTGGACAATGC
                      ____________________________________________________________
consensus TAAAGAAATGACCAAGGCTGGTGTTATTGAAGAGATGATGAATGATGCCGTGGACAATGC
 
. : . : . : . : . : . :
rJMSF014H17+ ATTGGATTCAGAAGACATAGAAGAGGAAACTGAAGAAGAAATTGATAAGGTTTTGACAGC
rJMFF036M15+ ATTGGATTCAGAAGACATAGAAGAGGAAACTGAAGAAGAAATTGATAAGGTTTTGACAGC
rJMFF001I20+ ATTGGATTCAGAAGACATAGAAGAGGAAACTGAAGAAGAAATTGATAAGGTTTTGACAGC
rJMFF032O03+ ATTGGATTCAGAAGACATAGAAGAGGAAACTGAAGAAGAAATTGATAAGGTTTTGACAGC
rJMFF021J03+ ATTGGATTCAGAAGACATAGAAGAGGAAACTGAAGAAGAAATTGATAAGGTTTTGACAGC
                      ____________________________________________________________
consensus ATTGGATTCAGAAGACATAGAAGAGGAAACTGAAGAAGAAATTGATAAGGTTTTGACAGC
 
. : . : . : . : . : . :
rJMSF014H17+ AATTGCCGGTGAGACTGCTGCAGAGCTGCCTGAAGCAGTCAGAAAGCAAAAACTAAAGCA
rJMFF036M15+ AATTGCCGGTGAGACTGCTGCAGAGCTGCCTGAAGCAGTCAGAAAGC-AAAACTAAAGCA
rJMFF001I20+ AATTGCCGGTGAGACTGCTGCAGAGCTGCCTGAAGCAGTCAGAAAGCAAAAACTAAAGCA
rJMFF032O03+ AATTGCCGGTGAGACTGCTGCAGAGCTGCCTGAAGCAGTCAGAAAGCAAAAACTAAAGCA
rJMFF021J03+ AATTGCCGGTGAGACTGCTGCAGAGCTGCCTGAAGCAGTCAGAAAGCAAAAACTAAAGCA
                      ____________________________________________________________
consensus AATTGCCGGTGAGACTGCTGCAGAGCTGCCTGAAGCAGTCAGAAAGCAAAAACTAAAGCA
 
. : . : . : . : . : . :
rJMSF014H17+ ACCGGCACAAGAAGTAGAAGACACCGAGGGCGCCGACGATGAGGAAGAGCTGGAGGAACT
rJMFF036M15+ ACCGGCACAAGAAGTAGAAGACACCGAGGGCGCCGACGATGAGGAAGAGCTGGAGGAACT
rJMFF001I20+ ACCGGCACAAGAAGTAGAAGACACCGAGGGCGCCGACGATGAGGAAGAGCTGGAGGAACT
rJMFF032O03+ ACCGGCACAAGAAGTAGAAGACACCGAGGGCGCCGACGATGAGGAAGAGCTGGAGGAACT
rJMFF021J03+ ACCGGCACAAGAAGTAGAAGACACCGAGGGCGCCGACGATGAGGAAGAGCTGGAGGAACT
                      ____________________________________________________________
consensus ACCGGCACAAGAAGTAGAAGACACCGAGGGCGCCGACGATGAGGAAGAGCTGGAGGAACT
 
. : . : . : . : . : . :
rJMSF014H17+ AAGAGCCCGTCTTGCTAAAGTCCGCTCTTAAGCAAACTAAATTACTTCTCCCATTCCCTC
rJMFF036M15+ AAGAGCCCGTCTTGCTAAAGTCCGCTCTTAAGCAAACTAAATTACTTCTCCCATTCCCTC
rJMFF001I20+ AAGAGCCCGTCTTGCTAAAGTCCGCTCTTAAGCAAACTAAATTACTTCTCCCATTCCCTC
rJMFF032O03+ AAGAGCCCGTCTTGCTAAAGTCCGCTCTTAAGCAAACTAAATTACTTCTCCCATTCCCTC
rJMFF021J03+ AAGAGCCCGTCTTGCTAAAGTCCGCTCTTAAGCAAACTAAATTACTTCTCCCATTCCCTC
                      ____________________________________________________________
consensus AAGAGCCCGTCTTGCTAAAGTCCGCTCTTAAGCAAACTAAATTACTTCTCCCATTCCCTC
 
. : . : . : . : . : . :
rJMSF014H17+ GGCTACACAATGTAAACACATTCTTAACATAAGTAACATTATAACAGACACCTTGCCTGG
rJMFF036M15+ GGCTACACAATGTAAACACATTCTTAACATAAGTAACATTATAACAGACACCTTGCCTGG
rJMFF001I20+ GGCTACACAATGTAAACACATTCTTAACATAAGTAACATTATAACAGACACCTTGCCTGG
rJMFF032O03+ GGCTACACAATGTAAACACATTCTTAACATAAGTAACATTATAACAGACACCTTGCCTGG
rJMFF021J03+ GGCTACACAATGTAAACACATTCTTAACATAAGTAACATTATAACAGACACCTTGCCTGG
                      ____________________________________________________________
consensus GGCTACACAATGTAAACACATTCTTAACATAAGTAACATTATAACAGACACCTTGCCTGG
 
. : . : . : . : . : . :
rJMSF014H17+ TATCCATGTAGTAATATGTTTTTCAGTGTGTTCTGTAGTTCTTGTATCATAGGATA
rJMFF036M15+ TATCCATGTAGTAATATGTTTTTCAGTGTGTTCTGTAGTTCTTGTATCATAGGATAATGT
rJMFF001I20+ TATCCATGTAGTAATATGTTTTTCAGTGTGTTCTGTAGTTCTTGTATCATAGGATAATGT
rJMFF032O03+ TATCCATGTAGTAATATGTTTTTCAGTGTGTTCTGTAGTTCTTGTATCATAGGATAATGT
rJMFF021J03+ TATCCATGTAGTAATATGTTTTTCAGTGTGTTCTGTAGTTCTTGTATCATAGGATAATGT
                      ____________________________________________________________
consensus TATCCATGTAGTAATATGTTTTTCAGTGTGTTCTGTAGTTCTTGTATCATAGGATAATGT
 
. : . : . : . : . : . :
rJMFF036M15+ CCCA-TTGAACTAAATT
rJMFF001I20+ CCCA-TTGAACTAAATT
rJMFF032O03+ CCCATTTGAACTAAATTAATGAAAGTGATGTTTGTAATATACTGAATATTGGGTCAAAG
rJMFF021J03+ CCCATTTGAACTAAATTAATGAAAGTGATGTTTGTAATATACTGAATATTGGGTCAAAGT
                      ____________________________________________________________
consensus CCCATTTGAACTAAATTAATGAAAGTGATGTTTGTAATATACTGAATATTGGGTCAAAGT