Previous Contig 009215:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021G23Sequence531009215 (6)gb:AY087216_15722507e-14Arabidopsis thaliana clone 32890 mRNA, complete sequence.683009215 (6)gb:AB007647_15101852e-05Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJB21.
JMFF022E23Sequence530009215 (6)gb:AY087216_15722500.037Arabidopsis thaliana clone 32890 mRNA, complete sequence.674009215 (6)gb:AB007647_15101852e-07Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJB21.
JMFF030G22Sequence643009215 (6)gb:AY087216_15722508e-07Arabidopsis thaliana clone 32890 mRNA, complete sequence.713009215 (6)gb:AB007647_15101858e-17Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJB21.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF030G22- ATAGCATAAG
                      ____________________________________________________________
consensus ATAGCATAAG
 
. : . : . : . : . : . :
JMFF022E23- ATTTTAGGTTGGCAGCCATCCCCCTTTCCTCTCTTTTCATATTCTTATCTCTGAATCT
JMFF030G22- ACATTTTAGGTTGGCAGCCATCCCCCTTTCCTCTCTTTTCATATTCTTATCTCTGAATCT
                      ____________________________________________________________
consensus ACATTTTAGGTTGGCAGCCATCCCCCTTTCCTCTCTTTTCATATTCTTATCTCTGAATCT
 
. : . : . : . : . : . :
JMFF022E23- GCCTCCTCAGTTTTTTCCCTTTTGTTTCTCAAAAGGAAAATTCACTGAAAGAGAAAGAGA
JMFF030G22- GCCTCCTCAGTTTTTTCCCTTTTGTTTCTCAAAAGGAAAATTCACTGAAAGAGAAAGAGA
                      ____________________________________________________________
consensus GCCTCCTCAGTTTTTTCCCTTTTGTTTCTCAAAAGGAAAATTCACTGAAAGAGAAAGAGA
 
. : . : . : . : . : . :
JMFF022E23- ATCTGAGAAAATCTGAGAAAAACCCATACCGTATATCATTGAGTGATGGACAAGAAGCAT
JMFF030G22- ATCTGAGAAAATCTGAGAAAAACCCATACCGTATATCATTGAGTGATGGACAAGAAGCAT
                      ____________________________________________________________
consensus ATCTGAGAAAATCTGAGAAAAACCCATACCGTATATCATTGAGTGATGGACAAGAAGCAT
 
. : . : . : . : . : . :
JMFF022E23- CAGGAGATCAGAGACGACAAAGATGAAGAGAAGCAAGGGCGCAACAGAGTAAAGGAGGAA
JMFF030G22- CAGGAGATCAGAGACGACAAAGATGAAGAGAAGCAAGGGCGCAACAGAGTAAAGGAGGAA
JMFF021G23- AGGAGATCAGAGACGACAAAGATGAAGAGAAGCAAGGGCGCAACAGAGTAAAGGAGGAA
                      ____________________________________________________________
consensus CAGGAGATCAGAGACGACAAAGATGAAGAGAAGCAAGGGCGCAACAGAGTAAAGGAGGAA
 
. : . : . : . : . : . :
JMFF022E23- GAGGCGGCGGAAGAGCAAACATCGAGTAGTGGCAATGCCGCCGCCGCGTCACCGCCGTCA
JMFF030G22- GAGGCGGCGGAAGAGCAAACATCGAGTAGTGGCAATGCCGCCGCCGCGTCACCGCCGTCA
JMFF021G23- GAGGCGGCGGAAGAGCAAACATCGAGTAGTGGCAATGCCGCCGCCGCGTCACCGCCGTCA
                      ____________________________________________________________
consensus GAGGCGGCGGAAGAGCAAACATCGAGTAGTGGCAATGCCGCCGCCGCGTCACCGCCGTCA
 
. : . : . : . : . : . :
JMFF022E23- GCGTCGTCATCTCCGTCGCATGAATTTTCCTTCACCATTTCGCTCCATCAACCGTCTGCA
JMFF030G22- GCGTCGTCATCTCCGTCGCATGAATTTTCCTTCACCATTTCGCTCCATCAACCGTCTGCA
JMFF021G23- GCGTCGTCATCTCCGTCGCATGAATTTTCCTTCACCATTTCGCTCCATCAACCGTCTGCA
                      ____________________________________________________________
consensus GCGTCGTCATCTCCGTCGCATGAATTTTCCTTCACCATTTCGCTCCATCAACCGTCTGCA
 
. : . : . : . : . : . :
JMFF022E23- AAAGCCCCAGACAGAACGAAATCTCCGCCGCAGCCGTCGTCGTTCGCCGTCGACTTAACT
JMFF030G22- AAAGCCCCAGACAGAACGAAATCTCCGCCGCAGCCGTGGTCGTTCGCCGTCGACTTAACT
JMFF021G23- AAAGCCCCAGACAGAACGAAATCTCCGCCGCAGCCGTCGTCGTTCGCCGTCGACTTAACT
                      ____________________________________________________________
consensus AAAGCCCCAGACAGAACGAAATCTCCGCCGCAGCCGTCGTCGTTCGCCGTCGACTTAACT
 
. : . : . : . : . : . :
JMFF022E23- CCGGCCGATGAAATATTCTTCCACGGCCACTTGTTCCCCCTCCACCTCCTCTCCCACCTC
JMFF030G22- CCGGCCGATGAAATATTCTTCCACGGCCACTTGCTCCCCCTCCACCTCCTCTCCCACCTC
JMFF021G23- CCGGCCGATGAAATATTCTTCCACGGCCACTTGCTCCCCCTCCACCTCCTCTCCCACCTC
                      ____________________________________________________________
consensus CCGGCCGATGAAATATTCTTCCACGGCCACTTGCTCCCCCTCCACCTCCTCTCCCACCTC
 
. : . : . : . : . : . :
JMFF022E23- CCCGTCTCCCCTCGCTCCTCCACCAACTCGCTGGAAAGTTTCACCCTTCCCA
JMFF030G22- CCCGTCTCCCCTCGCTCCTCCACCAACTCGCTGGAAAGTTTCACCCTTCCCATAAAAGAA
JMFF021G23- CCCGTCTCCCCTCGCTCCTCCACCAACTCGCTGGAAAGTTTCACCCTTCCCATAAAAGAA
rJMFF030G22+ GAAAGTTTCACCNTTCCCATAAAAGAA
                      ____________________________________________________________
consensus CCCGTCTCCCCTCGCTCCTCCACCAACTCGCTGGAAAGTTTCACCCTTCCCATAAAAGAA
 
. : . : . : . : . : . :
JMFF030G22- TTGCTGGAAAACCAAAGCTCATCACAACAAAACCCCGGCAGCCAACCAGACAACCATGAT
JMFF021G23- TTGCTGGAAAACCAAAGCTCATCACAACAAAACCCCGGCAGCCAACCAGACAACCATGAT
rJMFF030G22+ TTGCTGGAAAACCAAAGCTCATCACAACAAAACCCCGGCAGCCAACCAGACAACCATGAT
                      ____________________________________________________________
consensus TTGCTGGAAAACCAAAGCTCATCACAACAAAACCCCGGCAGCCAACCAGACAACCATGAT
 
. : . : . : . : . : . :
JMFF030G22- CATCAGAAAAAACATTAATAACGATCAAAGAAC
JMFF021G23- CATCAG-AAAAACATTAATAACGATCAAAGAACCGAGGGGAAACCGAAATCCAGCAGGTC
rJMFF030G22+ CATCAG-AAAAACATTAATAACGATCAAAGAACCGAGGGGAAACCGAAATCCAGCAGGTC
                      ____________________________________________________________
consensus CATCAG-AAAAACATTAATAACGATCAAAGAACCGAGGGGAAACCGAAATCCAGCAGGTC
 
. : . : . : . : . : . :
JMFF021G23- GTTCTCCTTGTTCTGGCTACCGAAATGGAGAAAAGGGTACGAGGTAAGAGACA
rJMFF030G22+ GTTCTCCTTGTTCTGGCTACCGAAATGGAGAAAAGGGTACGAGGTAAGAGACAAGGAAGA
rJMFF022E23+ AGGAAGA
                      ____________________________________________________________
consensus GTTCTCCTTGTTCTGGCTACCGAAATGGAGAAAAGGGTACGAGGTAAGAGACAAGGAAGA
 
. : . : . : . : . : . :
rJMFF030G22+ GAAGGAAAAACATTGGAGGAAGCTAAAATTTGACATAACTCAGGTTGTGAAGAGGTACAT
rJMFF022E23+ GAAGGAAAAACATTGGAGGAAGCTAAAATTTGACATAACTCAGGTTGTGAAGAGGTACAT
rJMFF021G23+ ACTCAGGTTGTGAAGAGGTACAT
                      ____________________________________________________________
consensus GAAGGAAAAACATTGGAGGAAGCTAAAATTTGACATAACTCAGGTTGTGAAGAGGTACAT
 
. : . : . : . : . : . :
rJMFF030G22+ GAGAATGGTGAGACCACTCTTATCCTTCCGGCCCAGCAGAAGATCAGGGAATCTGCAGTT
rJMFF022E23+ GAGAATGGTGAGACCACTCTTATCCTTCCGGCCCAGCAGAAGATCAGGGAATNTGCAGTT
rJMFF021G23+ GAGAATGGTGAGACCACTNTTATCCTTCCGGCCCAGCAGAAGATCAGGGAATCTGCAGTT
                      ____________________________________________________________
consensus GAGAATGGTGAGACCACTCTTATCCTTCCGGCCCAGCAGAAGATCAGGGAATCTGCAGTT
 
. : . : . : . : . : . :
rJMFF030G22+ CGACCGGCAAGCTTATTCATATTCCGGCCACTTAAACCTGCGGCGCAAGAAAGATATTAG
rJMFF022E23+ CGACCGGCAAGCTTATTCATATTCCGGCCACTTAAACCTGCGGCGCAAGAAAGATATTAG
rJMFF021G23+ CGACCGGCAAGCTTATTCATATTCCGGCCACTTAAACCTGCGGCGCAAGAAAGATATTAG
                      ____________________________________________________________
consensus CGACCGGCAAGCTTATTCATATTCCGGCCACTTAAACCTGCGGCGCAAGAAAGATATTAG
 
. : . : . : . : . : . :
rJMFF030G22+ AGGCAAAAGAGGGGAGTATTCCGCGCCGGCATCGATGAGAACATCTCCGACAAACAGTGG
rJMFF022E23+ AGGCAAAAGAGGGGAGTATTCCGCGCCGGCATCGATGAGAACATCTCCGACAAACAGTGG
rJMFF021G23+ AGGCAAAAGAGGGGAGTATTCCGCGCCGGCATCGATGAGAACATCTCCGACAAACAGTGG
                      ____________________________________________________________
consensus AGGCAAAAGAGGGGAGTATTCCGCGCCGGCATCGATGAGAACATCTCCGACAAACAGTGG
 
. : . : . : . : . : . :
rJMFF030G22+ CATCCTCGTACCACCGGCAACTTCCCCTACTTCTTCAAGCGACAGCACCATGGAAGAGTT
rJMFF022E23+ CATCCTCGTACCACCGGCAACTTCCCCTACTTCTTCAAGCGACAGCACCATGGAAGAGTT
rJMFF021G23+ CATCCTCGTACCACCGGCAACTTCCCCTACTTCTTCAAGCGACAGCACCATGGAAGAGTT
                      ____________________________________________________________
consensus CATCCTCGTACCACCGGCAACTTCCCCTACTTCTTCAAGCGACAGCACCATGGAAGAGTT
 
. : . : . : . : . : . :
rJMFF030G22+ ACAGGCCGCCATTCAAGCTGCCATTGCTCACTGCAAGAAATCCATTCAAGTGGAAGATAA
rJMFF022E23+ ACAGGCCGCCATTCAAGCTGCCATTGCTCACTGCAAGAAATCCATTCAAGTGGAAGATAA
rJMFF021G23+ ACAGGCCGCCATTCAAGCTGCCATTGCTCACTGCAAGAAATCCATTCAAGTGGAAGATAA
                      ____________________________________________________________
consensus ACAGGCCGCCATTCAAGCTGCCATTGCTCACTGCAAGAAATCCATTCAAGTGGAAGATAA
 
. : . : . : . : . : . :
rJMFF030G22+ ACTCAAATGTCAAGATTAGGCCTGCACATGAGCATATCCCAAACTTCTTTTTAATTTAAT
rJMFF022E23+ ACTCAAATGTCAAGATTAGGCCTGCACATGAGCATATCCCAAACTTCTTTTTAATTTAAT
rJMFF021G23+ ACTCAAATGTCAAGATTAGGCCTGCACATGAGCATATCCCAAACTTCTTTTTAATTTAAT
                      ____________________________________________________________
consensus ACTCAAATGTCAAGATTAGGCCTGCACATGAGCATATCCCAAACTTCTTTTTAATTTAAT
 
. : . : . : . : . : . :
rJMFF030G22+ TTTCTCCCTTTTTTTTTAAATTACCATATTACTATTTTTTTGGTGCCGGGGAAATCCGCA
rJMFF022E23+ TTTCTCCCTTTTTTTTTAAATTACCATATTACTATTTTTTTGGTGCCGGGGAAATCCGCA
rJMFF021G23+ TTTCTCCCTTTTTTTTTAAATTACCATATTACTATTTTTTTGGTGCCGGGGAAATCCGCA
                      ____________________________________________________________
consensus TTTCTCCCTTTTTTTTTAAATTACCATATTACTATTTTTTTGGTGCCGGGGAAATCCGCA
 
. : . : . : . : . : . :
rJMFF030G22+ GCCATTAGTCAAGTAAATCAGAC
rJMFF022E23+ GCCATTAGTCAAGTAAATCAGACTATATTATTCATAGTTGACTGCCTCAAATCAAGAAGG
rJMFF021G23+ GCCATTAGTCAAGTAAATCAGACTATATTATTCATAGTTGACTGCCTCAAATCAAGAAGG
                      ____________________________________________________________
consensus GCCATTAGTCAAGTAAATCAGACTATATTATTCATAGTTGACTGCCTCAAATCAAGAAGG
 
. : . : . : . : . : . :
rJMFF022E23+ GCAATAAGCAGCTCTCAGAGAGGGAGGGAGTCGAAGTTGAAACTTTTAGTTATCACGTCA
rJMFF021G23+ GCAATAAGCAGCTCTCAGAGAGGGAGGGAGTCGAAGTTGAAACTTTTAGTTATCACGTCA
                      ____________________________________________________________
consensus GCAATAAGCAGCTCTCAGAGAGGGAGGGAGTCGAAGTTGAAACTTTTAGTTATCACGTCA
 
. : . : . : . : . : . :
rJMFF022E23+ ATAACTTGACTAACTTGTCTGTGGTTGCACCTACCATTTTATTATTGGATGGGTTATTGC
rJMFF021G23+ ATAACTTGACTAACTTGTCTGTGGTTGCTCCTACCATTTTATTATTGGATGGGTTATTGC
                      ____________________________________________________________
consensus ATAACTTGACTAACTTGTCTGTGGTTGCTCCTACCATTTTATTATTGGATGGGTTATTGC
 
. : . : . : . : . : . :
rJMFF022E23+ ATTTTAT
rJMFF021G23+ ATTTTATTAGCAATAATTAGTCTTGTTGTGTCACATATTGATGGAAACTACACATATGTA
                      ____________________________________________________________
consensus ATTTTATTAGCAATAATTAGTCTTGTTGTGTCACATATTGATGGAAACTACACATATGTA