Previous Contig 009213:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021G13Sequence552001074 (2)gb:AY046010_15615023e-11Arabidopsis thaliana unknown protein (At4g24500) mRNA, complete cds.765009213 (2)gb:BT001099_16353545e-13Arabidopsis thaliana clone C104716 (B) unknown protein (At4g24500) mRNA, complet
JMSF015H13Sequence549001074 (2)gb:AY046010_15615022e-11Arabidopsis thaliana unknown protein (At4g24500) mRNA, complete cds.747009213 (2)gb:BT001099_16353549e-14Arabidopsis thaliana clone C104716 (B) unknown protein (At4g24500) mRNA, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015H13+ CCAAGATTCAGTAACTTTGCAAACCATAGTCAT
                      ____________________________________________________________
consensus CCAAGATTCAGTAACTTTGCAAACCATAGTCAT
 
. : . : . : . : . : . :
rJMSF015H13+ GGACGAGGCCCTGGTTTTGATCACGCGCGAGGAAGTCCTGGTTTTGTTCATGGGCGAGGT
                      ____________________________________________________________
consensus GGACGAGGCCCTGGTTTTGATCACGCGCGAGGAAGTCCTGGTTTTGTTCATGGGCGAGGT
 
. : . : . : . : . : . :
rJMSF015H13+ AGTCCTGGTTTTGTTCATGGGCGAGGTAGCCCTGGTTTTGTTCATGGGCGAGGTAGCCCT
rJMFF021G13+ CATGGGCGAGGTAGCCCTGGTTTTGTTCATGGGCGAGGTAGCCCT
                      ____________________________________________________________
consensus AGTCCTGGTTTTGTTCATGGGCGAGGTAGCCCTGGTTTTGTTCATGGGCGAGGTAGCCCT
 
. : . : . : . : . : . :
rJMSF015H13+ GG-TTTTGATCATGGGCGGGGTAGTCCTGGTTTTTATCATGGGCAAGGTAGCCCTGGTTT
rJMFF021G13+ GGTTTTTGATCATGGGCGGGGTAGTCCTGNTTTTTATCATGGNCAAGGTAGCCNTGGTTT
                      ____________________________________________________________
consensus GGTTTTTGATCATGGGCGGGGTAGTCCTGGTTTTTATCATGGGCAAGGTAGCCCTGGTTT
 
. : . : . : . : . : . :
rJMSF015H13+ TGATCAAAGGCGAGGTAGAGGATATGTATTCAGTAATAGCCCCCGGCCATATTCAGGACG
rJMFF021G13+ TGATCAAAGGCGAGGTAGAGGATATGTATTCAGTAATAGCCCCCGGCCATATTCAGGACG
                      ____________________________________________________________
consensus TGATCAAAGGCGAGGTAGAGGATATGTATTCAGTAATAGCCCCCGGCCATATTCAGGACG
 
. : . : . : . : . : . :
rJMSF015H13+ TGCAAACAGCCCATACCAAGATTCAGGTAGAGGCAGGGGTAGATGGCAAGGTAATAATGT
rJMFF021G13+ TGCAAACAGCCCATACCAAGATTCAGGTAGAGGCAGGGGTAGATGGCAAGGTAATAATGT
                      ____________________________________________________________
consensus TGCAAACAGCCCATACCAAGATTCAGGTAGAGGCAGGGGTAGATGGCAAGGTAATAATGT
 
. : . : . : . : . : . :
rJMSF015H13+ TAGTTTTAGCTCTATGCAGAGTGGCAGGAGAGGATCAGGTAATCGGGAAGGCTCCTCAGC
rJMFF021G13+ TAGTTTTAGCTCTATGCAGAGTGGCAGGAGAGGATCAGGTAATCGGGAAGGCTCCTCAGC
                      ____________________________________________________________
consensus TAGTTTTAGCTCTATGCAGAGTGGCAGGAGAGGATCAGGTAATCGGGAAGGCTCCTCAGC
 
. : . : . : . : . : . :
rJMSF015H13+ AGAGGCAAGACCAGATCTATATTATAACACGTCAATGGTAGAAGATCCATGGGAACAATT
rJMFF021G13+ AGAGGCAAGACCAGATCTATATTATAACACGTCAATGGTAGAAGATCCATGGGAACAATT
                      ____________________________________________________________
consensus AGAGGCAAGACCAGATCTATATTATAACACGTCAATGGTAGAAGATCCATGGGAACAATT
 
. : . : . : . : . : . :
rJMSF015H13+ GCAGCCTACCATTTGGAAGAAAGTAAATACTCCCTCAAAGTACATAGATACCCCTGGCTC
rJMFF021G13+ GCAGCCTACCATTTGGAAGAAAGTAAATACTCCCTCAAAGTACATAGATACCCCTGGCTC
                      ____________________________________________________________
consensus GCAGCCTACCATTTGGAAGAAAGTAAATACTCCCTCAAAGTACATAGATACCCCTGGCTC
 
. : . : . : . : . : . :
rJMSF015H13+ ACATAAATCACGGCTTCCAAATTCCATCAGTATGAAAAAGGCGAGGCTTGCAGAAGTTCA
rJMFF021G13+ ACATAAATCACGGCTTCCAAATTCCATCAGTATGAAAAAGGCGAGGCTTGCAGAAGTTCA
                      ____________________________________________________________
consensus ACATAAATCACGGCTTCCAAATTCCATCAGTATGAAAAAGGCGAGGCTTGCAGAAGTTCA
 
. : . : . : . : . : . :
rJMSF015H13+ AGTGAAGTTAAGCTCTCAGCAAAGCCTTGCCGAATATCTTGCTGCCTCGTTTAATGAAGC
rJMFF021G13+ AGTGAAGTTAAGCTCTCAGCAAAGCCTTGCCGAATATCTTGCTGCCTCGTTTAATGAAGC
                      ____________________________________________________________
consensus AGTGAAGTTAAGCTCTCAGCAAAGCCTTGCCGAATATCTTGCTGCCTCGTTTAATGAAGC
 
. : . : . : . : . : . :
rJMSF015H13+ AGCCAACGAGGGTGAAAATGACAAGTCTAGTGCATGATTTTGACTCTGAAAACTCAAATA
rJMFF021G13+ AGCCAACGAGGGTGAAAATGACAAGTCTAGTGCATGATTTTGACTCTGAAAACTCAAATA
                      ____________________________________________________________
consensus AGCCAACGAGGGTGAAAATGACAAGTCTAGTGCATGATTTTGACTCTGAAAACTCAAATA
 
. : . : . : . : . : . :
rJMSF015H13+ GAGCCATGTAGTGACTACTGCTTCTGTTTGACACCTAGTGTTTATAAGAATCTTG
rJMFF021G13+ GAGCCATGTAGTGACTACTGCTTCTGTTTGACACCTAGTGTTTATAAGAATCTTGTAATT
                      ____________________________________________________________
consensus GAGCCATGTAGTGACTACTGCTTCTGTTTGACACCTAGTGTTTATAAGAATCTTGTAATT
 
. : . : . : . : . : . :
rJMFF021G13+ TTTCTAAATATTTGTCATTTCATATTTAGTCAAAGGAATCACAACAAAAAAAATGAGTGT
                      ____________________________________________________________
consensus TTTCTAAATATTTGTCATTTCATATTTAGTCAAAGGAATCACAACAAAAAAAATGAGTGT
 
. : . : . : . : . : . :
rJMFF021G13+ TTGTTTTGAAAGTTATTTGAGATTCCTTACTCCAAGAAGTCAAAGCTTAATCAAACACNT
                      ____________________________________________________________
consensus TTGTTTTGAAAGTTATTTGAGATTCCTTACTCCAAGAAGTCAAAGCTTAATCAAACACNT