Previous Contig 009212:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013A02Sequence520003420 (7)gb:S75487_17045142e-34adh3a=alcohol dehydrogenase ADH, adh3b=alcohol dehydrogenase ADH [Lycopersicon e726009212 (5)gb:S75487_17045133e-59adh3a=alcohol dehydrogenase ADH, adh3b=alcohol dehydrogenase ADH [Lycopersicon e
JMFF013F19Sequence484003420 (7)gb:S75487_17045148e-37adh3a=alcohol dehydrogenase ADH, adh3b=alcohol dehydrogenase ADH [Lycopersicon e630009212 (5)gb:S75487_17045133e-31adh3a=alcohol dehydrogenase ADH, adh3b=alcohol dehydrogenase ADH [Lycopersicon e
JMFF021G12Sequence519003420 (7)gb:S75487_17045145e-36adh3a=alcohol dehydrogenase ADH, adh3b=alcohol dehydrogenase ADH [Lycopersicon e755009212 (5)gb:AB023032_15153312e-29Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14.>gb:AY081332_156
JMFF028G21Sequence523003420 (7)gb:S75487_17045141e-45adh3a=alcohol dehydrogenase ADH, adh3b=alcohol dehydrogenase ADH [Lycopersicon e724009212 (5)gb:S75487_17045133e-63adh3a=alcohol dehydrogenase ADH, adh3b=alcohol dehydrogenase ADH [Lycopersicon e
JMSF034M16Sequence663003420 (7)gb:S75487_17045142e-58adh3a=alcohol dehydrogenase ADH, adh3b=alcohol dehydrogenase ADH [Lycopersicon e721009212 (5)gb:S75487_17045138e-94adh3a=alcohol dehydrogenase ADH, adh3b=alcohol dehydrogenase ADH [Lycopersicon e

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034M16+ GGCTTGCCTCCTAAGCTGTGGAGTGTCAACTGGAGTAGGCGCTGCAATCAGATCAGC
                      ____________________________________________________________
consensus GGCTTGCCTCCTAAGCTGTGGAGTGTCAACTGGAGTAGGCGCTGCAATCAGATCAGC
 
. : . : . : . : . : . :
rJMSF034M16+ GAATGTGGAACCGGGATCAACTGTTGCTATCTTTGGTTTGGGATCAATTGGATTAGCGGT
                      ____________________________________________________________
consensus GAATGTGGAACCGGGATCAACTGTTGCTATCTTTGGTTTGGGATCAATTGGATTAGCGGT
 
. : . : . : . : . : . :
rJMSF034M16+ TGCGGAGGGAGCCAGGCTTTGTGGCGCTGCAAGAATTATCGGTGTGGATATAAATCCAGA
rJMFF028G21+ CGGAGGGAGCCAGGCTTTGTGGCGCTGCAAGAATTATCGGTGTGGATATAAATCCAGA
                      ____________________________________________________________
consensus TGCGGAGGGAGCCAGGCTTTGTGGCGCTGCAAGAATTATCGGTGTGGATATAAATCCAGA
 
. : . : . : . : . : . :
rJMSF034M16+ TAAATTTGAGAGAGGTAAAACATTTGGGGTTTCCGACTTTGTCAATTCTTTGACTATTGG
rJMFF028G21+ TAAATTTGAGATAGGTAAAACATTTGGGGTTTCCGACTTTGTCAATTCTTTGACTATTGG
rJMFF013A02+ TCCGACTTTGTCAATTCTTTGACTATTGG
                      ____________________________________________________________
consensus TAAATTTGAGATAGGTAAAACATTTGGGGTTTCCGACTTTGTCAATTCTTTGACTATTGG
 
. : . : . : . : . : . :
rJMSF034M16+ GAATAAATCAGTAAGCCAGGTGATATGTGAGATGACT-GGGGGCGGTGCAGACTATTGCT
rJMFF028G21+ GAATAAATCAGTAAGCCAGGTGATATGTGAGATGACT-GGGGGCGGTGCAGACTATTGCT
rJMFF013A02+ GAATAAATCAGTAAGCCAGGTGATATGTGAGATGACT-GGGGGCGGTGCAGACTATTGCT
rJMFF021G12+ CCAGGTGATATGTGAGATGACTAGGGGGCGGTGCAGACTATTGCT
                      ____________________________________________________________
consensus GAATAAATCAGTAAGCCAGGTGATATGTGAGATGACT-GGGGGCGGTGCAGACTATTGCT
 
. : . : . : . : . : . :
rJMSF034M16+ TTGAATGCGTCGGCCAGGCAACATTGGTGCAGGAAGCATACG-CCAGCTGCCGGAAGGGT
rJMFF028G21+ TTGAATGTGCCGGCCAGGCAACATTGGTGCAGGAAGCATATG-CCAGCTGCCGGAAGGGT
rJMFF013A02+ TTGAATGCGTCGGCCAGGCAACATTGGTGCAGGAAGCATACG-CCAGCTGCCGGAAGGGT
rJMFF013F19+ CATTGATGCAGGAAGCATATGCCCAGCTGCCGGAAGGGT
rJMFF021G12+ TGGAATGTGCCGGCCAGGCAACATTGATGCAGGAAGCATATG-CCAGCTGCCGGAAGGGT
                      ____________________________________________________________
consensus TTGAATGTGTCGGCCAGGCAACATTGGTGCAGGAAGCATATG-CCAGCTGCCGGAAGGGT
 
. : . : . : . : . : . :
rJMSF034M16+ TGGGGCAAGACAGTGGTTTTAGGAGTTGATAAGCCCGGAGCGCAGCTGAGCTTGAACTCT
rJMFF028G21+ TGGGGCAAGACAGTGGTTTTAGGAGTTGATCAGCCCGGAAC---GCTGAACTTGAACTCT
rJMFF013A02+ TGGGGCAAGACAGTGGTTTTAGGAGTTGATAAGCCCGGAGCGCAGCTGAGCTTGAACTCT
rJMFF013F19+ TGGGGCAAGACAGTGGTTTTAGGAGTTGATCAGCCCGGAAC---GCTGAACTTGAACTCT
rJMFF021G12+ TGGGGCAAGACAGTGG-TTTAGGAGTTGATCAGCCCGGAAC---GCTGAACTTGAACTCT
                      ____________________________________________________________
consensus TGGGGCAAGACAGTGGTTTTAGGAGTTGATCAGCCCGGAAC---GCTGAACTTGAACTCT
 
. : . : . : . : . : . :
rJMSF034M16+ TTCGAGGTTCTTCACAGTGGCAAAACCCTCATCGGGTCGCTGTTTGGAGGTCTCAAGCCA
rJMFF028G21+ TTTGAGGTTCTTCACAGTGGCAAAACCCTCACCGGGAAGCTGTTCGGAGGTCTCAAGCCA
rJMFF013A02+ TTCGAGGTTCTTCACAGTGGCAAAACCCTCATCGGGTCGCTGTTTGGAGGTCTCAAGCCA
rJMFF013F19+ TTTGAGGTTCTTCACAGTGGCAAAACCCTCACCGGGAAGCTGTTCGGAGGTCTCAAGCCA
rJMFF021G12+ TTTGAGGTTCTTCACAGTGGCAAAACCCTCACCGGGAAGCTGTTCGGAGGTCTCAAGCCA
                      ____________________________________________________________
consensus TTTGAGGTTCTTCACAGTGGCAAAACCCTCACCGGGAAGCTGTTCGGAGGTCTCAAGCCA
 
. : . : . : . : . : . :
rJMSF034M16+ AAATCTGATATCCCCGTCCTTGCTAAGCGTTACTCAGATGGGGAACTAGAACTAGATAAA
rJMFF028G21+ AAATCTGATATCCCCGTCCTTGCTAAGCGTTACACAGATGGGGAACTAGAACTAGATAAA
rJMFF013A02+ AAATCTGATATCCCCGTCCTTGCTAAGCGTTACTCAGATGGGGAACTAGAACTAGATAAA
rJMFF013F19+ AAATCTGATATCCCCGTCCTTGCTAAGCGTTACACAGATGGGGAACTAGAACTAGATAAA
rJMFF021G12+ AAATCTGATATCCCCGTCCTTGCTAAGCGTTACACAGATGGGGAACTAGAACTAGATAAA
                      ____________________________________________________________
consensus AAATCTGATATCCCCGTCCTTGCTAAGCGTTACACAGATGGGGAACTAGAACTAGATAAA
 
. : . : . : . : . : . :
rJMSF034M16+ TTTGTTACTCATGAAGTGGGTTTTGAAGACATCAACAAAGCTTTTGACTTGCTTATTCAA
rJMFF028G21+ TTTGTGACTCATGAAGTGGGTTTTGAAGACATCAACAAAGCTTTTGACTTGCTTATTCAA
rJMFF013A02+ TTTGTTACTCATGAAGTGGGTTTTGAAGACATCAACAAAGCTTTTGACTTGCTTATTCAA
rJMFF013F19+ TTTGTGACTCATGAAGTGGGTTTTGAAGACATCAACAAAGCTTTTGACTTGCTTATTCAA
rJMFF021G12+ TTTGTGACTCATGAAGTGGGTTTTGAAGACATCAACAAAGCTTTTGACTTGCTTATTCAA
                      ____________________________________________________________
consensus TTTGTGACTCATGAAGTGGGTTTTGAAGACATCAACAAAGCTTTTGACTTGCTTATTCAA
 
. : . : . : . : . : . :
rJMSF034M16+ GGGAAAAGCTTAAGGTGTGTTATTTGGATGGATAAGTGATTCTTTCTATGCTATCAATCA
rJMFF028G21+ GGGAAAAGCTTAAGGTGTGTTATTTGGATGGATAAGTGATAC-TTCTATGGT----ATCA
rJMFF013A02+ GGGAAAAGCTTAAGGTGTGTTATTTGGATGGATAAGTGATTCTTTCTATGCTATCAATCA
rJMFF013F19+ GGGAAAAGCTTAAGGTGTGTTATTTGGATGGATAAGTGATAC-TTCTATGGT----ATCA
rJMFF021G12+ GGGAAAAGCTTAAGGTGTGTTATTTGGATGGATAAGTGATAC-TTCTATGGT----ATCA
                      ____________________________________________________________
consensus GGGAAAAGCTTAAGGTGTGTTATTTGGATGGATAAGTGATAC-TTCTATGGT----ATCA
 
. : . : . : . : . : . :
rJMSF034M16+ CTATGTGTATCTTACATTGCTCTTTATATGTAATTGCTATATATATTGTGTAAG
rJMFF028G21+ CTATGTGTATCTTACATTGCTCTTTATATGCAATTGCTATATATATTGTGTAAGTAA---
rJMFF013A02+ CTATGTGTATCTTACATTGCTCTTTATATGTAATTGCTATATATATTGTGTAAGTAACCC
rJMFF013F19+ CTATGTGTATCTTACATTGCTCTTTATATGCAATTGCTATATATATTGTGTAAGTAA---
rJMFF021G12+ CTATGTGTATCTTACATTGCTCTTTATATGCAATTGCTATATATATTGTGTAAGTAA---
                      ____________________________________________________________
consensus CTATGTGTATCTTACATTGCTCTTTATATGCAATTGCTATATATATTGTGTAAGTAA---
 
. : . : . : . : . : . :
rJMFF028G21+ -----CATATGTAATACCTATGTTTGTGTCTGTTGATTGGCATCGATCAATATCTCTTGC
rJMFF013A02+ AAAACCATAT-TTATACCTATGTTTGTGTCTGTTGATTGGCATCGATCAATATCTCTTGC
rJMFF013F19+ -----CATATGTAATACCTATGTTTGTGTCTGTTGATTGGCATCGATCAATATCTCTTGC
rJMFF021G12+ -----CATATGTAATACCTATGTTTGTGTCTGTTGATTGGCATCGATCAATATCTCTTGC
                      ____________________________________________________________
consensus -----CATATGTAATACCTATGTTTGTGTCTGTTGATTGGCATCGATCAATATCTCTTGC
 
. : . : . : . : . : . :
rJMFF028G21+ ACTAGGTACACACCCAAAATGCTTTGGGGGAAGTTTTGGGTATCAAATCGTTTCGATAGT
rJMFF013A02+ ACTAGGTACACA-CCAAAAAGCTTTGGGGGAAGTTTTGGGTATCAAATTGTTTCGATATT
rJMFF013F19+ ACTAGGTACACACCCAAAATGCTTTGGGGGAAGTTTTGGGTATCAAATCGTTTCGATAGT
rJMFF021G12+ ACTAGGTACACACCCAAAATGCTTTGGGGGAAGTTTTGGGTATCAAATCGTTTCGATAGT
                      ____________________________________________________________
consensus ACTAGGTACACACCCAAAATGCTTTGGGGGAAGTTTTGGGTATCAAATCGTTTCGATAGT
 
. : . : . : . : . : . :
rJMFF028G21+ A-TTGATACAAACT
rJMFF013A02+ ACTTGATACAAACTCAAACTTTTTGTATTCATTCTTTTGTT---TGCAAAAGATATTGAT
rJMFF013F19+ A-TTGATACAAACTTAAATATTTTGTATTCATTCTTTTGTTGTGTGCAAAAGACATTGAT
rJMFF021G12+ A-TTGATACAAACTTAAATATTTTGTATTCATTCTTTTGTTGTGTGCAAAAGACATTGAT
                      ____________________________________________________________
consensus A-TTGATACAAACTTAAATATTTTGTATTCATTCTTTTGTTGTGTGCAAAAGACATTGAT
 
. : . : . : . : . : . :
rJMFF013A02+ GCCGATCGGGTTAGTAATTGAACCTCTATAATTTGTATTGCTCT
rJMFF013F19+ GCTGATCGGGTTAGTGATTGAACCTCTATAATTTGTATTGCTCTGTGTCA-TGAATAAG-
rJMFF021G12+ GCTGATCGGGTTAGTGATTGAACCTCTATAATTTGTATTGCTCTGTGTCATTGAATAAGT
                      ____________________________________________________________
consensus GCTGATCGGGTTAGTGATTGAACCTCTATAATTTGTATTGCTCTGTGTCATTGAATAAGT
 
. : . : . : . : . : . :
rJMFF013F19+ TGAAACAATA
rJMFF021G12+ TGAAACAATATATTTATTACATGCGTGCATGCAATATGTTTGCATACATATGCCAAGTTA
                      ____________________________________________________________
consensus TGAAACAATATATTTATTACATGCGTGCATGCAATATGTTTGCATACATATGCCAAGTTA