Previous Contig 009208:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021E24Sequence511006074 (5)gb:AC123513_11924104e-23Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN738009208 (5)gb:BT004190_16372874e-38Arabidopsis thaliana clone RAFL15-36-F11 (R50132) unknown protein (At4g26500) mR
JMFF032O14Sequence559006074 (5)gb:AC123513_11924104e-21Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN707009208 (5)gb:BT004190_16372873e-42Arabidopsis thaliana clone RAFL15-36-F11 (R50132) unknown protein (At4g26500) mR
JMSF006G01Sequence366006074 (5)357009208 (5)gb:BT004190_16372872e-16Arabidopsis thaliana clone RAFL15-36-F11 (R50132) unknown protein (At4g26500) mR
JMSF022J01Sequence659006074 (5)gb:AC123513_11924101e-21Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN435009208 (5)gb:BT004190_16372873e-20Arabidopsis thaliana clone RAFL15-36-F11 (R50132) unknown protein (At4g26500) mR
JMSF043A12Sequence649006074 (5)gb:AC123513_11924101e-21Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN431009208 (5)gb:BT004190_16372873e-15Arabidopsis thaliana clone RAFL15-36-F11 (R50132) unknown protein (At4g26500) mR

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF032O14+ TGCTCAAGTTGATGCAG
rJMFF021E24+ ATGCTCAAGTTGATGCAG
                      ____________________________________________________________
consensus ATGCTCAAGTTGATGCAG
 
. : . : . : . : . : . :
rJMFF032O14+ AAGAAGGCTCTG-CAGTTGTATGTGGAAGCTGAAAAGACAGGAAGTTTGGGTCATGATGA
rJMFF021E24+ AAGAAGGCTCTGCCAGTTGTATGTGGAAGCTGAAAAGACAGGAAGTTTGGGTCATGATGA
                      ____________________________________________________________
consensus AAGAAGGCTCTGCCAGTTGTATGTGGAAGCTGAAAAGACAGGAAGTTTGGGTCATGATGA
 
. : . : . : . : . : . :
rJMFF032O14+ GGATGCAAGCAATACAACTGAGAGCTCGAATTTTGGAGTGACGAATGATAATGGAAATGA
rJMFF021E24+ GGATGCAAGCAATACAACTGAGAGCTCGAATTTTGGAGTGACGAATGATAATGGAAATGA
                      ____________________________________________________________
consensus GGATGCAAGCAATACAACTGAGAGCTCGAATTTTGGAGTGACGAATGATAATGGAAATGA
 
. : . : . : . : . : . :
rJMFF032O14+ GAATTTGAAGACTGGACTGAGTTCTGAAGAGAGTGGTGGTAATGATAGTAAAGCAGTATC
rJMSF022J01+ AAGAGAGTGGTGGTAATGATAGTAAAGCAGNATC
rJMFF021E24+ GAATTTGAAGACTGGACTGAGTTCTGAAGAGAGTGGTGGTAATGATAGTAAAGCAGTATC
                      ____________________________________________________________
consensus GAATTTGAAGACTGGACTGAGTTCTGAAGAGAGTGGTGGTAATGATAGTAAAGCAGTATC
 
. : . : . : . : . : . :
rJMFF032O14+ GTGTGATAGTGTTATTTTGGGGAGTCGGGGGATGAGAATTAGGGAGAGATTGGAGAGGGA
rJMSF022J01+ GTGTGATAGTGNTATTTTGGGGAGTCGGGGGATGAGAATTAGGGAGAGATTGGAGAGGGA
rJMSF043A12+ GGATGAGAANTAGGGAGAGATTGGAGAGGGA
rJMFF021E24+ GTGTGATAGTGTTATTTTGGGGAGTCGGGGGATGAGAATTAGGGAGAGATTGGAGAGGGA
                      ____________________________________________________________
consensus GTGTGATAGTGTTATTTTGGGGAGTCGGGGGATGAGAATTAGGGAGAGATTGGAGAGGGA
 
. : . : . : . : . : . :
rJMFF032O14+ TCTAATGCCTGCTGAATTGGACGTTGAAGATATTTCATATCAGCATGCTGGTCATGCTGG
rJMSF022J01+ TNTAATGCCTNCTGAANNGGACGTCGAAGATATTTCATNTCAGCANCCTGGTCATNCTGG
rJMSF043A12+ TNTAATGCCTNCTGAANNGGACGTNGAAGATATTTCATNTCAGCATCCTGGTCATCCTGG
rJMFF021E24+ TCTAATGCCTGCTGAATTGGACGTTGAAGATATTTCATATCAGCATGCTGGTCATGCTGG
                      ____________________________________________________________
consensus TCTAATGCCTGCTGAATTGGACGTTGAAGATATTTCATATCAGCATGCTGGTCATGCTGG
 
. : . : . : . : . : . :
rJMFF032O14+ GGTTAGGGGCAGTGATGGTGAGACACATTTCAATGTGAGAGTGGTTTCTGAGAAGTTTGA
rJMSF006G01+ GATGGTGAGACACATTTCAATGTGAGAGTGGNTTNTGAGAAGTNTGA
rJMSF022J01+ GGTTAGGGGCAGCGATGNTGAGACACNTCTCAANGTGAGAGNGGTTTCTNAGAAGTNTGA
rJMSF043A12+ GGTTAGGGGCAGCGATGNTGAGACACNTCTCAANGTGAGAGNGGTTTCTNAGAAGTTTGA
rJMFF021E24+ GGTTAGGGGCAGTGATGGTGAGACACATTTCAATGTGAGAGTGGTTTCTGAGAAGTTTGA
                      ____________________________________________________________
consensus GGTTAGGGGCAGTGATGGTGAGACACATTTCAATGTGAGAGTGGTTTCTGAGAAGTTTGA
 
. : . : . : . : . : . :
rJMFF032O14+ GGGCAAGAGTTTGGTTAAGAGGCATAGATTGATTTATGATTTGCTGCAAGAGGAGTTGCA
rJMSF006G01+ GGGCAAGAGTTTGGTTAAGAGGCATAGATTGATTTATGATTTGCTGCAAGAGGAGNTGCA
rJMSF022J01+ GGGCAANAGNNTGGTTAAGAGGCATNGATTGATTTATGATNTGCTGCAANAGGAGNNGCA
rJMSF043A12+ GGGCAANAGNTTGGTTAAGAGGCATNGATNGATNTATGATNTGCTGCAANAGGAGNNGCA
rJMFF021E24+ GGGCAAGAGTTTGGTTAAGAGGCATAGATTGATTTATGATTTGCTGCAAGAGGAGTTGCA
                      ____________________________________________________________
consensus GGGCAAGAGTTTGGTTAAGAGGCATAGATTGATTTATGATTTGCTGCAAGAGGAGTTGCA
 
. : . : . : . : . : . :
rJMFF032O14+ GGGTGGACTTCATGCGCTGTCCATCATTGCTAAGACACCATCTGAAGTAAATAGTAGGTG
rJMSF006G01+ GGGTGGACTTCATGCGCTGTCCATCATTGCTAAGACACCATCTGAAGTAAATAGTAGGTG
rJMSF022J01+ GNGNGGACTTCATNCGCNGTCCATCATNGNTAAGACNCCATCTNAAGTAAATAGTAGGTG
rJMSF043A12+ GNGNGGACNTCATNCGCTGTCCATCATCGCTAAGACNCCATCTNAAGTAAATAGTAGGTG
rJMFF021E24+ GGGTGGACTTCATGCGCTGTCCATCATTGCTAAGACACCATCTGAAGTAAATAGTAGGTG
                      ____________________________________________________________
consensus GGGTGGACTTCATGCGCTGTCCATCATTGCTAAGACACCATCTGAAGTAAATAGTAGGTG
 
. : . : . : . : . : . :
rJMFF032O14+ AAAATCTCAGCTTTAAAAAGGTCTTAGCATTCTTTCTCATTTAAGTTCTTATTGAAATTG
rJMSF006G01+ AAAATCTCAGCTTTAAAAAGGTCTTAGCATTCTTTNTCATTTAAGTTCTTAATGAAATTG
rJMSF022J01+ AAAATCTCANCTTNAAAAAGGTCNTAGCATNCTTTCTCATCTAAGTTCTTATTGAAANTG
rJMSF043A12+ AAAATCTCANCTTNAAAAAGGTNNTAGCATNCTTTCTCATCTAAGTTNTTATTGAAATNG
rJMFF021E24+ AAAATCTCAGCTTTAAAAAGGTCTTAGCATTCTTTCTCATTTAAGTTCTTATTGAAATTG
                      ____________________________________________________________
consensus AAAATCTCAGCTTTAAAAAGGTCTTAGCATTCTTTCTCATTTAAGTTCTTATTGAAATTG
 
. : . : . : . : . : . :
rJMFF032O14+ GTTTTTGTTAGTACCAATATTGTGCTATTATAGGCACTTGAAACAAGAGATTTTGAAAGA
rJMSF006G01+ GTTTTTGTTAGTACCAATATTGNGCTNNTATAGGCACTTGAAACAAGAGATTTTGAAAGA
rJMSF022J01+ GTNTTTGTTAGTACCAANATTGTGCTATTATAGGCAC
rJMSF043A12+ GTTTTTGTTAGTACCAANATTGTGCTATTATAGGCACCNGAAACAANAGATNNTGAAAGA
rJMFF021E24+ GTTTTTGTTAGTACCAATATTGTGCTATTATAGGCACTTGAAACAAGAGATTTTGAAAGA
                      ____________________________________________________________
consensus GTTTTTGTTAGTACCAATATTGTGCTATTATAGGCACTTGAAACAAGAGATTTTGAAAGA
 
. : . : . : . : . : . :
rJMFF032O14+ TGTTTTCTTTTCCTTTTAGAACCATGAGAAGGATATAGGATTTGTACTACCCTGTAAAAA
rJMSF006G01+ TGTTTTCTTTTCCTTTNAGANCCATNAGAAGGANATAGGATNTGTACTACCCTGTAAAAA
rJMSF043A12+ TGTTNTCTTNTCCT
rJMFF021E24+ TGTTTTCTTTTCCTTTTAGAACCATGAGAAGGATATAGGATTTGTACTACCCTGTAAAAA
                      ____________________________________________________________
consensus TGTTTTCTTTTCCTTTTAGAACCATGAGAAGGATATAGGATTTGTACTACCCTGTAAAAA
 
. : . : . : . : . : . :
rJMFF032O14+ ATAGTTCAAGAACTTGTTTTCCTATGTACTA
rJMSF006G01+ ATAG
rJMFF021E24+ ATAGTTCAAGAACTTGTTTTCCTATGTACTATGTTCTGTTTAGTATGTTACTCAACAATT
                      ____________________________________________________________
consensus ATAGTTCAAGAACTTGTTTTCCTATGTACTATGTTCTGTTTAGTATGTTACTCAACAATT