Previous Contig 009207:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021E20Sequence504001071 (4)pir|T07833|T078331e-27probable steroid sulfotransferase (EC 2.8.2.15) 3 - rape>gb:AF000307_1760488 Bra521009207 (3)gb:AB026651_15172614e-17Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQD19.>gb:BT010865_1640
JMFF045K04Sequence626001071 (4)pir|T07833|T078338e-38probable steroid sulfotransferase (EC 2.8.2.15) 3 - rape>gb:AF000307_1760488 Bra547009207 (3)pir|T47447|T474472e-32sulfotransferase-like protein - Arabidopsis thaliana>gb:ATT14D3_1554441 Arabidop
JMFF049O13Sequence521001071 (4)pir|T07833|T078336e-28probable steroid sulfotransferase (EC 2.8.2.15) 3 - rape>gb:AF000307_1760488 Bra510009207 (3)pir|A96769|A967691e-19protein flavonol sulfotransferase F2P9.3 [imported] - Arabidopsis thaliana>gb:AE

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045K04+ TGCCGGGGAGCAAGTATGTTTGGGCCTTTCTGGGATCATGTGTTGGG
                      ____________________________________________________________
consensus TGCCGGGGAGCAAGTATGTTTGGGCCTTTCTGGGATCATGTGTTGGG
 
. : . : . : . : . : . :
rJMFF045K04+ ATACTGGAAGGAGAGCTTGGAGAATCCTGGGAAGGTGTTGTTCTTGAAGTACGAGGAGAT
rJMFF049O13+ TGGGAAGGTGTGGTTCTTGAAGTACGAGGAGAT
rJMFF021E20+ GAGAATCCTGGGAAGGTGTTGTTNTTGAAGTACGAGGAGAT
                      ____________________________________________________________
consensus ATACTGGAAGGAGAGCTTGGAGAATCCTGGGAAGGTGTTGTTCTTGAAGTACGAGGAGAT
 
. : . : . : . : . : . :
rJMFF045K04+ TAAGGAAGAGCCTGAAGTTGAGTTGAGGCGAATTGCAGGTTTCTTGGGGTGTCCATTTTT
rJMFF049O13+ TAAGGAAGAGCCTGAAGTTGAGTTGAGGCGAATTGCAGGTTTCTTGGGGTGTCCATTTTC
rJMFF021E20+ TAAGGAAGAGCCTGAAGTTGAGTTGAGGCGAATTGCAGGTTTCTTGGGGTGTCCATTTTT
                      ____________________________________________________________
consensus TAAGGAAGAGCCTGAAGTTGAGTTGAGGCGAATTGCAGGTTTCTTGGGGTGTCCATTTTT
 
. : . : . : . : . : . :
rJMFF045K04+ TGAGGAGGAAGAAGAGGGAGGTGTGGTAGGTGGAATCTCGAGGCTTTGCAGCTTTGAAAG
rJMFF049O13+ TGAGGAGGAAGAAGAGGGAGGTGTGGTAGGTGGAATCTCGAGGCTTTGCAGCTTTGAAAG
rJMFF021E20+ TGAGGAGGAAGAAGAGGGAGGTGTGGTAGGTGGAATNTCGAGGCTTTGCAGCTTTGAAAG
                      ____________________________________________________________
consensus TGAGGAGGAAGAAGAGGGAGGTGTGGTAGGTGGAATCTCGAGGCTTTGCAGCTTTGAAAG
 
. : . : . : . : . : . :
rJMFF045K04+ CTTGAGCAACTTGGAGGTTAACAAGACTGGTAAGACCTATCATGAGAGGCCAAATAATGT
rJMFF049O13+ CTTGAGCAACTTGGAGGTTAACAAGACTGGTAAGACCTATCATGAGAGGCCAAATAATGT
rJMFF021E20+ CTTGAGCAACTTGGAGGTTAACAAGACTGGTAAGACCTATCATGAGAGGCCAAATAATGT
                      ____________________________________________________________
consensus CTTGAGCAACTTGGAGGTTAACAAGACTGGTAAGACCTATCATGAGAGGCCAAATAATGT
 
. : . : . : . : . : . :
rJMFF045K04+ GTATTTTAGGAAAGGTAAGGTTGGAGATTGGAGGAACCATCTAACAAATGAAATGGCCCC
rJMFF049O13+ GTATTTTAGGAAAGGTAAGGTTGGAGATTGGAGGAACCATCTAACAAATGAAATGGCCAC
rJMFF021E20+ GTATTTTAGGAAAGGTAAGGTTGGAGATTGGAGGAACCATNTAACAAATGAAATGGCCNC
                      ____________________________________________________________
consensus GTATTTTAGGAAAGGTAAGGTTGGAGATTGGAGGAACCATCTAACAAATGAAATGGCCCC
 
. : . : . : . : . : . :
rJMFF045K04+ CAGACTTGATCAAATTGTTGAACAGTAGTTCAAAGGGACAGGGCTCAA
rJMFF049O13+ CAGACTTGATCAAATTGTTGAACAAAAGTTCAAAGGGACAGGGCTCAA
rJMFF021E20+ CAGACTTGATCAAATTGTTGAACAAAAGTTCAAAGGGACAGGGCTCAAGGTGTGATGTGA
                      ____________________________________________________________
consensus CAGACTTGATCAAATTGTTGAACAAAAGTTCAAAGGGACAGGGCTCAAGGTGTGATGTGA
 
. : . : . : . : . : . :
rJMFF021E20+ TGATCAAGTGCGTAGANAATCATTTTGTGACTGTGCTTTAATTTGATAATGATATTTTTT
                      ____________________________________________________________
consensus TGATCAAGTGCGTAGANAATCATTTTGTGACTGTGCTTTAATTTGATAATGATATTTTTT
 
. : . : . : . : . : . :
rJMFF021E20+ TTTTATTGTGTTTAAGTAGAAGTGTGGTTCAAATTTAGTTTAATGTCCTTTATAAATCAA
                      ____________________________________________________________
consensus TTTTATTGTGTTTAAGTAGAAGTGTGGTTCAAATTTAGTTTAATGTCCTTTATAAATCAA
 
. : . : . : . : . : . :
rJMFF021E20+ AGTATTGTTATTCCTGTATTAATAAACTTCTAAAAATGTGCAGCAGCCATCCAAGTATGT
                      ____________________________________________________________
consensus AGTATTGTTATTCCTGTATTAATAAACTTCTAAAAATGTGCAGCAGCCATCCAAGTATGT