Previous Contig 009195:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021B09Sequence497009195 (2)gb:AJ635581_18133547e-15Medicago sativa subsp. falcata mRNA for Mob1-like protein (mob1 gene), allele mu714009195 (2)gb:MSA319713_16870336e-91Medicago sativa subsp. falcata mRNA for Mob1-like protein (mob1 gene), allele wi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF021B09- AAA
                      ____________________________________________________________
consensus AAA
 
. : . : . : . : . : . :
JMFF021B09- TAGGCAGCGGCGTGGAGTTGGAGGTGAGGGGAAGCCAGGTTGGCTGAGCGATGGCAGAGC
                      ____________________________________________________________
consensus TAGGCAGCGGCGTGGAGTTGGAGGTGAGGGGAAGCCAGGTTGGCTGAGCGATGGCAGAGC
 
. : . : . : . : . : . :
JMFF021B09- AAGAAGACGGCCTGTCTCTTAGCTTGCTACTCTTTCTTTCTTTGGCTTATTCTTCTTCCA
                      ____________________________________________________________
consensus AAGAAGACGGCCTGTCTCTTAGCTTGCTACTCTTTCTTTCTTTGGCTTATTCTTCTTCCA
 
. : . : . : . : . : . :
JMFF021B09- TTTACAACTTTTATATACAAAATACATACAGAGTCGTCTCTGTTGCTGTGATGTTGTCCT
                      ____________________________________________________________
consensus TTTACAACTTTTATATACAAAATACATACAGAGTCGTCTCTGTTGCTGTGATGTTGTCCT
 
. : . : . : . : . : . :
JMFF021B09- GCTTCAACTCCCCTTTGCCTTGCCAGTCTGTCATCTCTCCCGCATTCTCCCCAACCACTC
                      ____________________________________________________________
consensus GCTTCAACTCCCCTTTGCCTTGCCAGTCTGTCATCTCTCCCGCATTCTCCCCAACCACTC
 
. : . : . : . : . : . :
JMFF021B09- ACCCACCCACCCACCACCCTCAAACACAAATATATGAACACCCTTTCCTTCTGCAACATA
                      ____________________________________________________________
consensus ACCCACCCACCCACCACCCTCAAACACAAATATATGAACACCCTTTCCTTCTGCAACATA
 
. : . : . : . : . : . :
JMFF021B09- TATGCGTATGTGTACAAGCTCGACAAACCCTTTGATCCTCAATCATGAGTCTTCTTGGCC
                      ____________________________________________________________
consensus TATGCGTATGTGTACAAGCTCGACAAACCCTTTGATCCTCAATCATGAGTCTTCTTGGCC
 
. : . : . : . : . : . :
JMFF021B09- TTGCAAGCAGAAACCAGAAGACATTTCATCCTAAGAAGAGTGTTCCACCAGGAAACAAGG
                      ____________________________________________________________
consensus TTGCAAGCAGAAACCAGAAGACATTTCATCCTAAGAAGAGTGTTCCACCAGGAAACAAGG
 
. : . : . : . : . : . :
JMFF021B09- GTGAACTACTCCAGAAACATATTGATGCCACCTTGGGGAGTGGCAATTTGAGGGAAGCAG
rJMFF021B09+ TACTCCAGAAACATATTGATGCCACCTTGGGGAGTGGCAATTTGAGGGAAGCAG
                      ____________________________________________________________
consensus GTGAACTACTCCAGAAACATATTGATGCCACCTTGGGGAGTGGCAATTTGAGGGAAGCAG
 
. : . : . : . : . : . :
JMFF021B09- TGCTGCTGCCAGCA
rJMFF021B09+ TGCTGCTGCCAGCAGGGGAAGATCTTAATGAGTGGTTGGCTGTAAATACTGTTGACTTCT
                      ____________________________________________________________
consensus TGCTGCTGCCAGCAGGGGAAGATCTTAATGAGTGGTTGGCTGTAAATACTGTTGACTTCT
 
. : . : . : . : . : . :
rJMFF021B09+ TTAACCAGGTGAATATATTGTATGGCACTCTCACTGAGTTCTGCACCCCATCAAGTTGTC
                      ____________________________________________________________
consensus TTAACCAGGTGAATATATTGTATGGCACTCTCACTGAGTTCTGCACCCCATCAAGTTGTC
 
. : . : . : . : . : . :
rJMFF021B09+ CAATGATGACTGCAGGACCAAAGTACGAGTGCCTTTGGGCAGATGGAGTGACTATAAAGA
                      ____________________________________________________________
consensus CAATGATGACTGCAGGACCAAAGTACGAGTGCCTTTGGGCAGATGGAGTGACTATAAAGA
 
. : . : . : . : . : . :
rJMFF021B09+ AACCCATAAAAGTTTCTGCTCCAAAATATGTTGATTATTTGATGGATTGGATTGAAAAAC
                      ____________________________________________________________
consensus AACCCATAAAAGTTTCTGCTCCAAAATATGTTGATTATTTGATGGATTGGATTGAAAAAC
 
. : . : . : . : . : . :
rJMFF021B09+ AGCTGGATGATGAATCAATATTTCCCCAAAAGTTCGGTGCTCCATTTCCACCAAACTTTG
                      ____________________________________________________________
consensus AGCTGGATGATGAATCAATATTTCCCCAAAAGTTCGGTGCTCCATTTCCACCAAACTTTG
 
. : . : . : . : . : . :
rJMFF021B09+ AGGACGTTGTGAAGACGATAGTTAAGAGACTGTTCCGTGTGTATGCTCATATCTACCACT
                      ____________________________________________________________
consensus AGGACGTTGTGAAGACGATAGTTAAGAGACTGTTCCGTGTGTATGCTCATATCTACCACT
 
. : . : . : . : . : . :
rJMFF021B09+ CGCATTTCCAGAAGATCATTGGTTTGAAGGAAGAAGCTCATCTTAATACTTGCTTCAAAC
                      ____________________________________________________________
consensus CGCATTTCCAGAAGATCATTGGTTTGAAGGAAGAAGCTCATCTTAATACTTGCTTCAAAC
 
. : . : . : . : . : . :
rJMFF021B09+ ATTTTGTTATGTTCTCATGGGAGTTTCACTTGATTGACAAGAATGGAGTTGCACCTCTGT
                      ____________________________________________________________
consensus ATTTTGTTATGTTCTCATGGGAGTTTCACTTGATTGACAAGAATGGAGTTGCACCTCTGT
 
. : . : . : . : . : . :
rJMFF021B09+ ACGAGATTGTTGAATCCATTTTGCAGTTGTAGGGTAGAATCCTGCTAATTTTCATTCCAT
                      ____________________________________________________________
consensus ACGAGATTGTTGAATCCATTTTGCAGTTGTAGGGTAGAATCCTGCTAATTTTCATTCCAT
 
. : . : . : . : . : . :
rJMFF021B09+ TCCATTCCATTCATTTTTATAATTCTTTGATTAGCTTCTCTGTAAATAGAATGATCTGAA
                      ____________________________________________________________
consensus TCCATTCCATTCATTTTTATAATTCTTTGATTAGCTTCTCTGTAAATAGAATGATCTGAA
 
. : . : . : . : . : . :
rJMFF021B09+ ATTCATGCTTTCTACATTTTTCTTCTTCTTATTAAAAGGGTACCATGTTTAACCTTNTAA
                      ____________________________________________________________
consensus ATTCATGCTTTCTACATTTTTCTTCTTCTTATTAAAAGGGTACCATGTTTAACCTTNTAA