Previous Contig 009191:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021A18Sequence486014482pir|T07172|T071721e-72subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi670009191 (8)pir|T07172|T071722e-44subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi
JMFF021I18Sequence254009191 (8)pir|T07172|T071722e-04subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi
JMFF044H02Sequence647011913 (3)pir|T07172|T071724e-97subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi536009191 (8)pir|T07172|T071722e-30subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi
JMFS047B06Sequence640009191 (8)pir|T07172|T071727e-64subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi
JMFS096F02Sequence552009191 (8)pir|T07172|T071722e-62subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi
JMSF016M03Sequence529009191 (8)pir|T07172|T071721e-47subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi771011913 (3)pir|T07172|T071721e-81subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi
JMSF034I16Sequence703011913 (3)pir|T07172|T07172e-110subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi778009191 (8)pir|T07172|T071724e-69subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi
JMSF049L13Sequence487009191 (8)pir|T07172|T071722e-50subtilisin-like proteinase (EC 3.4.21.-) 2 - tomato>gb:LES6379_1684622 Lycopersi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034I16+ CCGGACGCGGCTTCATAGCCGTGGTAGAACATTCTAGCGCCGACTATCTTTTAT
                      ____________________________________________________________
consensus CCGGACGCGGCTTCATAGCCGTGGTAGAACATTCTAGCGCCGACTATCTTTTAT
 
. : . : . : . : . : . :
JMFS047B06+ AGTGATGTTTCGCGAACCCGCGGCNTATCTCGCACGCGCCCTTCCAGTTAGCCGGAA
JMFS096F02+ TTCGCGAACCCGCGGCCTATCTCGCACGCGCCCTTCCAGTTAGCCGGAA
rJMSF034I16+ TACAGTGATGTTTCGCGAACCCGCGGCCTATCTCGCACGCGCCCTTCCAGTTAGCCGGAA
                      ____________________________________________________________
consensus TACAGTGATGTTTCGCGAACCCGCGGCCTATCTCGCACGCGCCCTTCCAGTTAGCCGGAA
 
. : . : . : . : . : . :
JMSF016M03+ CCATATCCCGGTGTCGAGCA
JMSF049L13+ TTCCGGTGTCATTGAAGCTCGGGCTCTCCGGCCATATCCCGGNGTCGAGCA
JMFS047B06+ CCGCCGCCATTCCGGTGTCATTGAAGCTCGGGCTCTCCGGCCATATCCCGGTGTCGAGCA
JMFS096F02+ CCGCCGCCATTCCGGTGTCATTGAAGCTCGGGCTCTCCGGCCATATCCCGGTGTCGAGCA
rJMSF034I16+ CCGCCGCCATTCCGGTGTCATTGAAGCTCGGGCTCTCCGGCCATATCCCGGTGTCGAGCA
rJMFF021A18+ GTGTCGAGCA
                      ____________________________________________________________
consensus CCGCCGCCATTCCGGTGTCATTGAAGCTCGGGCTCTCCGGCCATATCCCGGTGTCGAGCA
 
. : . : . : . : . : . :
JMSF016M03+ CGCCGACAACGACATTATTGCTGTACAGTTTCCCACCCCAAAGATTCTCGGCTGCTTTTC
JMSF049L13+ CGCCGACAACGACATTANTGCTGTACAGTTTCCCACCCCAAAGATTCTCGGCTGCTTTTC
JMFS047B06+ CGCCGACAACGACATTATTGCTGTACAGTTTCCCACCCCAAAGATTCTCGGCTGCTTTTC
JMFS096F02+ CGCCGACAACGACATTATTGCTGTACAGTTTCCCACCCCAAAGATTCTCGGCTGCTTTTC
rJMSF034I16+ CGCCGACAACGACATTATTGCTGTACAGTTTCCCACCCCAAAGATTCTCGGCTGCTTTTC
rJMFF021A18+ CGCCGACAACGACATTATTGCTGTACAGTTTCCCACCCCAAAGATTCTCGGCTGCTTTTC
                      ____________________________________________________________
consensus CGCCGACAACGACATTATTGCTGTACAGTTTCCCACCCCAAAGATTCTCGGCTGCTTTTC
 
. : . : . : . : . : . :
JMSF016M03+ GATAAAGCCCAAGAAACATAGGACTTCTGGTGGTGTGGAGTTTATAGATAGTCTCAGGGA
JMSF049L13+ GATAAAGCCCAAGAAACATAGGACTTCTGGTGGTGTGGAGNTTATAGATAGTCTCAGGGA
JMFS047B06+ GATAAAGCCCAAGAAACATAGGACTTCTGGTGGTGTGGAGTTTATAGATAGTCTCAGGGA
JMFS096F02+ GATAAAGCCCAAGAAACATAGGACTTCTGGTGGTGTGGAGTTTATAGATAGTCTCAGGGA
rJMSF034I16+ GATAAAGCCCAAGAAACATAGGACTTCTGGTGGTGTGGAGTTTATAGATAGTCTCAGGGA
rJMFF044H02+ TAGATAGTCTCAGGGA
rJMFF021A18+ GATAAAGCCCAAGAAACATAGGACTTCTGGTGGTGTGGAGTTTATAGATAGTCTCAGGGA
                      ____________________________________________________________
consensus GATAAAGCCCAAGAAACATAGGACTTCTGGTGGTGTGGAGTTTATAGATAGTCTCAGGGA
 
. : . : . : . : . : . :
JMSF016M03+ AAACTGCTAAGACGCCATGTTGTTTTTGCAGTCTCTGAACTTCATCTTCTGTGAGCTGAG
JMSF049L13+ AAACTGNTAAGACGCCATGTTGTTTTTGCAGTCTNTGAACTTCATCTTCTGTGAGTTGAG
JMFS047B06+ AAACTGCTAAGACGCCATGTTGTTTTTGCAGTCTCTGAACTTCATCTTCTGTGAGCTGAG
JMFS096F02+ AAACTGCTAAGACGCCATGTTGTTTTTGCAGTCTCTGAACTTCATCTTCTGTGAGCTGAG
rJMSF034I16+ AAACTGCTAAGACGCCATGTTGTTTTTGCAGTCTCTGAACTTCATCTTCTGTGAGCTGAG
rJMFF044H02+ AAACTGCTAAGACGCCATGTTGTTTTTGCAGTCTCTGAACTTCATCTTCTGTGAGCTGAG
rJMFF021A18+ AAACTGCTAAGACGCCATGTTGTTTTTGCAGTCTCTGAACTTCATCTTCTGTGAGCTGAG
                      ____________________________________________________________
consensus AAACTGCTAAGACGCCATGTTGTTTTTGCAGTCTCTGAACTTCATCTTCTGTGAGCTGAG
 
. : . : . : . : . : . :
JMSF016M03+ CAGAAACTCCATGGAAGGCTGTCTGGTAACTGTAAAGCACCCTTTCCTCCTCGGCACTCC
JMSF049L13+ CAGAAACTCCATGGAAGGCTGTCTGGTAACTGTAAAGCACCCTTTCCTCCTCGGCACTCC
JMFS047B06+ CAGAAACTCCATGGAAGGCTGTCTGGTAACTGTAAAGCACCCTTTCCTCCTCGGCACTCC
JMFS096F02+ CAGAAACTCCATGGAAGGCTGTCTGGTAACTGTAAAGCACCCTTTCCTCCTCGGCACTCC
rJMSF034I16+ CAGAAACTCCATGGAAGGCTGTCTGGTAACTGTAAAGCACCCTTTCCTCCTCGGCACTCC
rJMFF044H02+ CAGAAACTCCATGGAAGGCTGTCTGGTAACTGTAAAGCACCCTTTCCTCCTCGGCACTCC
rJMFF021A18+ CAGAAACTCCATGGAAGGCTGTCTGGTAACTGTAAAGCACCCTTTCCTCCTCGGCACTCC
                      ____________________________________________________________
consensus CAGAAACTCCATGGAAGGCTGTCTGGTAACTGTAAAGCACCCTTTCCTCCTCGGCACTCC
 
. : . : . : . : . : . :
JMSF016M03+ CTCTTTCTTGTTCTTGCTGGAACACTACTGATCTTATTAGCGACGAGTACCATTGGCCAT
JMSF049L13+ CTCTNTCTTGTTCTTGCNGGAACACTACTGATNTTATTAGCGACGAGTACCATTGGCCAT
JMFS047B06+ CTCTTTCTTGTTCTTGCTGGAACACTACTGATCTTATTAGCGACGAGTACCATTGGCCAT
JMFS096F02+ CTCTTTCTTGTTCTTGCTGGAACACTACTGATCTTATTAGCGACGAGTACCATTGGCCAT
rJMSF034I16+ CTCTTTCTTGTTCTTGCTGGAACACTACTGATCTTATTAGCGACGAGTACCATTGGCCAT
rJMFF044H02+ CTCTTTCTTGTTCTTGCTGGAACACTACTGATCTTATTAGCGACGAGTACCATTGGCCAT
rJMFF021A18+ CTCTTTCTTGTTCTTGCTGGAACACTACTGATCTTATTAGCGACGAGTACCATTGGCCAT
                      ____________________________________________________________
consensus CTCTTTCTTGTTCTTGCTGGAACACTACTGATCTTATTAGCGACGAGTACCATTGGCCAT
 
. : . : . : . : . : . :
JMSF016M03+ AGCCGGTGAATACCTCCGGCTTTGCCCATTTATCCATCTGGACAATGTATGTTTTCTTTG
JMSF049L13+ AGCCGGTGAATACCTCCGGCTTNGCCCATTTATCCATCTGGACAANGTATGTTTTCTTTG
JMFS047B06+ AGCCGGTGAATACCTCCGGCTTTGCCCATTTATCCATCTGGACAATGTATGTTTTCTTTG
JMFS096F02+ AGCCGGTGAATACCTCCGGCTTTGCCCATTTATCCATCTGGACAATGTATGTTTTCTTTG
rJMSF034I16+ AGCCGGTGAATACCTCCGGCTTTGCCCATTTATCCATCTGGACAATGTATGTTTTCTTTG
rJMFF044H02+ AGCCGGTGAATACCTCCGGCTTTGCCCATTTATCCATCTGGACAATGTATGTTTTCTTTG
rJMFF021I18+ TCCGGCTTTGCCCATTTATCCATNNGGACAANGTATGTTTTCTTTG
rJMFF021A18+ AGCCGGTGAATACCTCCGGCTTTGCCCATTTATCCATCTGGACAATGTATGTTTTCTTTG
                      ____________________________________________________________
consensus AGCCGGTGAATACCTCCGGCTTTGCCCATTTATCCATCTGGACAATGTATGTTTTCTTTG
 
. : . : . : . : . : . :
JMSF016M03+ GGCTTGAGCCATTGGCGAAAGTGCAGGCAAGGCAAATAGACAAGAAGAGAAAAATGCACT
JMSF049L13+ GGCTTGAGCCATTGGCGAAAGTGCAGGCAAGGCAAATAGACAAGAAGAGAAAAATGCACT
JMFS047B06+ GGCTTGAGCCATTGGCGAAAGTGCAGGCAAGGCAAATAGACAAGAAGAGAAAAATGCACT
JMFS096F02+ GGCTTGAGCCATTGGCGAAAGTGCAGGCAAGGCAAATAGACAAGAAGAGAAAAATGCACT
rJMSF034I16+ GGCTTGAGCCATTGGCGAAAGTGCAGGCAAGGCAAATAGACAAGAAGAGAAAAATGCACT
rJMFF044H02+ GGCTTGAGCCATTGGCGAAAGTGCAGGCAAGGCAAATAGACAAGAAGAGAAAAATGCACT
rJMFF021I18+ GGCTTGAGCCATTGGNGAAAGTGCAGGCAAGGCAAATAGACAAGAAGAGAAAAATGCACT
rJMFF021A18+ GGCTTGAGCCATTGGCGAAAGTGCAGGCAAGGCAAATAGACAAGAAGAGAAAAATGCACT
                      ____________________________________________________________
consensus GGCTTGAGCCATTGGCGAAAGTGCAGGCAAGGCAAATAGACAAGAAGAGAAAAATGCACT
 
. : . : . : . : . : . :
JMSF016M03+ TCACTGAGATTCTCTCCATTGTTTCTGACGAAAGAGAGAGTGAATGAGGGAAGAAGATGG
JMSF049L13+ TCANTGAGATTCTCTC
JMFS047B06+ TCACTGAGATTCTCTCCATTGTTTCTGACGAAAGAGAGAGTGAATGAGGGAAGAAGATGG
JMFS096F02+ TCACTGAGATTCTCTCCATTGTT
rJMSF034I16+ TCACTGAGATTCTCTCCATTGTTTCTGACGAAAGAGAGAGTGAATGAGGGAAGAAGATGG
rJMFF044H02+ TCACTGAGATTCTCTCCATTGTTTCTGACGAAAGAGAGAGTGAATGAGGGAAGAAGATGG
rJMFF021I18+ TCACTGAGATTCTCTCCATTGTTTCTGACGAAAGAGAGAGTGAATGAGGGAAGAANANGG
rJMFF021A18+ TCACTGAGATTCTCTCCATTGTTTCTGACGAAAGAGAGAGTGAATGAGGGAAGAAGATGG
                      ____________________________________________________________
consensus TCACTGAGATTCTCTCCATTGTTTCTGACGAAAGAGAGAGTGAATGAGGGAAGAAGATGG
 
. : . : . : . : . : . :
JMSF016M03+ GAATGATGAGGTGGTCTTACTGACTC
JMFS047B06+ GAATGATGAGGTGGTCTTACTGACTCGGTGACTTTGGAATTAG
rJMSF034I16+ GAATGATGAGGTGGTCTTACTGACTCGGTGACTTTGGAATTAGATACAACATTGAGTAAA
rJMFF044H02+ GAATGATGAGGTGGTCTTACTGACTCGGTGACTTTGGAATTAGATACAACATTGAGTAAA
rJMFF021I18+ NAATGATGAGGTGGTCTTANTGATTCGGTGACTTTGGAATTAGATACAACATTGAGTAAA
rJMFF021A18+ GAATGATGAGGTGGTCTTACTGATTCGGTGACTTTGGAATTAGATACAACATTGAGTAAA
                      ____________________________________________________________
consensus GAATGATGAGGTGGTCTTACTGACTCGGTGACTTTGGAATTAGATACAACATTGAGTAAA
 
. : . : . : . : . : . :
rJMSF034I16+ AAGATTGCATTACAATCCCAAATTTTCACAGCCACTATCTTTTACATACAAGTT
rJMFF044H02+ AAGATTGCATTACAATCCCAAATTTTCACAGCCACTATCTTTTACATACAAGTTTGTTAA
rJMFF021I18+ AAGATTGCATTACAATCCCAAATTTT
rJMFF021A18+ AAGATTGCATTACAATCCCAAATTTTCACAGCCACTATCTTTTACATACAAGTTTGTTAA
                      ____________________________________________________________
consensus AAGATTGCATTACAATCCCAAATTTTCACAGCCACTATCTTTTACATACAAGTTTGTTAA
 
. : . : . : . : . : . :
rJMFF044H02+ AGGTCAATATTTCTGTAAACAGTATTTGAGAGGAGAGA
rJMFF021A18+ AGGTCAATATTTCTGTAAACAGTATTTGAGAGGAGAGATCAAAATTCAGGACTACAACAA
                      ____________________________________________________________
consensus AGGTCAATATTTCTGTAAACAGTATTTGAGAGGAGAGATCAAAATTCAGGACTACAACAA