Previous Contig 009188:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002L06Sequence581009188 (17)gb:AB026646_15171873e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565
JMFF004P06Sequence567009188 (17)gb:AB026646_15171873e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565679009188 (17)gb:AB026646_15171874e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565
JMFF020P08Sequence560009188 (17)gb:AB026646_15171873e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565692009188 (17)gb:AB026646_15171874e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565
JMFF026H22Sequence557009188 (17)gb:AB026646_15171873e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565699009188 (17)gb:AB026646_15171874e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565
JMFF030P15Sequence502009188 (17)gb:AB026646_15171872e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565626009188 (17)gb:AB026646_15171873e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565
JMFF038F19Sequence539009188 (17)gb:AB026646_15171872e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565647009188 (17)gb:AB026646_15171874e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565
JMFN005P12Sequence597009188 (17)gb:AB026646_15171873e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565
JMFN038G21Sequence627009188 (17)gb:AB026646_15171873e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565
JMFN039J10Sequence607009188 (17)gb:AB026646_15171873e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565
JMFN040G02Sequence572009188 (17)gb:AB026646_15171871e-40Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565
JMSF031L24Sequence639009188 (17)gb:AB026646_15171874e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565631009188 (17)gb:AB026646_15171873e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIG5.>gb:AY063848_1565

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF026H22- TATGATTAATTGATAAGAAAGAATACTAAC
                      ____________________________________________________________
consensus TATGATTAATTGATAAGAAAGAATACTAAC
 
. : . : . : . : . : . :
JMFN038G21+ TGAGAAAAGGCATTCCCAGATTTCACTACTAAGTGTCTAGATTTATAACAGT
rJMFF026H22- TTCCTCTTTGAGAAAAGGCATTCCCAGATTTCACTACTAAGTGTCTAGATTTATAACAGT
rJMFF038F19- CTACTAAGTGTCTAGATTTATAACAGT
rJMSF031L24- TAGATTTATAACAGT
JMSF031L24+ TAAGTGTCTAGATTTATAACAGT
rJMFF030P15- TTTATAACAGT
JMFN039J10+ TAGATTTATAACAGT
JMFN005P12+ CAGT
JMFN040G02+ AGATTTATAACAGT
rJMFF004P06- CTACTAAGTGTCTAGATTTATAACAGT
rJMFF020P08- CTACTAAGTGTCTAGATTTATAACAGT
                      ____________________________________________________________
consensus TTCCTCTTTGAGAAAAGGCATTCCCAGATTTCACTACTAAGTGTCTAGATTTATAACAGT
 
. : . : . : . : . : . :
JMFN038G21+ ATTTGCTACATTATACTCAATATTTGGTTCTTGAAAACACAAGATGGCAGAAGCATGTCA
rJMFF026H22- ATTTGCTACATTATACTCAATATTTTGGTCTTGAAAACACAAGATGGCAGAAGCATGTCA
rJMFF038F19- ATTTGCTACATTATACTCAATATTTTGGTCTTGAAAACACAAGATGGCAGAAGCATGTCA
rJMSF031L24- ATTTGCTACATTATACTCAATATTTTGGTCTTGAAAACACAAGATGGCAGAAGCATGTCA
JMSF031L24+ ATTTGCTACATTATACTCAATATTTTGGTCTTGAAAACACAAGATGGCAGAAGCATGTCA
rJMFF030P15- ATTTGCTACATTATACTCAATATTTTGGTCTTGAAAACACAAGATGGCAGAAGCATGTCA
JMFN039J10+ ATTTGCTACATTATACTCAATATTTTGGTC-TGAAAACACAAGATGGCAGAAGCATGTCA
JMFN005P12+ ATTTGCTACATTATACTCAATATTTTGGTCTTGAAAACACAAGATGGCAGAAGCATGTCA
JMFF026H22+ AAGATGGCAGAAGCATGTCA
JMFF002L06+ TGAAAACACAAGATGGCAGAAGCATGTCA
JMFN040G02+ ATTTGCTACATTATACTCAATATTTTGGTCTTGAAAACACAAGATGGCAGAAGCATGTCA
rJMFF004P06- ATTTGCTACATTATACTCAATATTTTGGTCTTGAAAACACAAGATGGCAGAAGCATGTCA
rJMFF020P08- ATTTGCTACATTATACTCAATATTTTGGTCTTGAAAACACAAGATGGCAGAAGCATGTCA
                      ____________________________________________________________
consensus ATTTGCTACATTATACTCAATATTTTGGTCTTGAAAACACAAGATGGCAGAAGCATGTCA
 
. : . : . : . : . : . :
JMFN038G21+ TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
rJMFF026H22- TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
rJMFF038F19- TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
rJMSF031L24- TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
JMSF031L24+ TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
rJMFF030P15- TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
JMFN039J10+ TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
JMFN005P12+ TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
JMFF026H22+ TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
JMFF002L06+ TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
JMFN040G02+ TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
JMFF038F19+ AAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
JMFF030P15+ TCCTAGA
rJMFF004P06- TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
JMFF004P06+ TCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
JMFF020P08+ ATACATATAATCTTCAATGCTGATCCATCCTAGA
rJMFF020P08- TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
                      ____________________________________________________________
consensus TGTGACTAAAACACTGAAATCGCAACATACATATAATCTTCAATGCTGATCCATCCTAGA
 
. : . : . : . : . : . :
JMFN038G21+ CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
rJMFF026H22- CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
rJMFF038F19- CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
rJMSF031L24- CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
JMSF031L24+ CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
rJMFF030P15- CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
JMFN039J10+ CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
JMFN005P12+ CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
JMFF026H22+ CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
JMFF002L06+ CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
JMFN040G02+ CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
JMFF038F19+ CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
JMFF030P15+ CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
rJMFF004P06- CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
JMFF004P06+ CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
JMFF020P08+ CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
rJMFF020P08- CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
                      ____________________________________________________________
consensus CTCCCAACTCACACACAACTACACTGGTAATTGAAATATATGGCAAGAGCGAAGAGCCGA
 
. : . : . : . : . : . :
JMFN038G21+ AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
rJMFF026H22- AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
rJMFF038F19- AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
rJMSF031L24- AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
JMSF031L24+ AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
rJMFF030P15- AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
JMFN039J10+ AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
JMFN005P12+ AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
JMFF026H22+ AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
JMFF002L06+ AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
JMFN040G02+ AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
JMFF038F19+ AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
JMFF030P15+ AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
rJMFF004P06- AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
JMFF004P06+ AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
JMFF020P08+ AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
rJMFF020P08- AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
                      ____________________________________________________________
consensus AGAGCTAGTTGTCCTTGGCTCTCTTTTCCACTTCCTCCATCCTTTGGATCTCCTTGTTGT
 
. : . : . : . : . : . :
JMFN038G21+ ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
rJMFF026H22- ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
rJMFF038F19- ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
rJMSF031L24- ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
JMSF031L24+ ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
rJMFF030P15- ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
JMFN039J10+ ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
JMFN005P12+ ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
JMFF026H22+ ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
JMFF002L06+ ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
JMFN040G02+ ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
JMFF038F19+ ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
JMFF030P15+ ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
rJMFF004P06- ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
JMFF004P06+ ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
JMFF020P08+ ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
rJMFF020P08- ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
                      ____________________________________________________________
consensus ACTTGCAGATGCGGTAGATACACCAGTAAAGGAGGCATGCTGCCACACAAAGGATGCCAT
 
. : . : . : . : . : . :
JMFN038G21+ TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
rJMFF026H22- TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
rJMFF038F19- TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
rJMSF031L24- TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
JMSF031L24+ TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
rJMFF030P15- TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
JMFN039J10+ TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
JMFN005P12+ TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
JMFF026H22+ TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
JMFF002L06+ TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
JMFN040G02+ TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
JMFF038F19+ TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
JMFF030P15+ TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
rJMFF004P06- TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
JMFF004P06+ TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
JMFF020P08+ TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
rJMFF020P08- TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
                      ____________________________________________________________
consensus TCCTTTGAGCCTTGTAGATCGATTTCTCATAGCGGTCTCTCTCGGCGGCAGTGCAGATCT
 
. : . : . : . : . : . :
JMFN038G21+ CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
rJMFF026H22- CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
rJMFF038F19- CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
rJMSF031L24- CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
JMSF031L24+ CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
rJMFF030P15- CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
JMFN039J10+ CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
JMFN005P12+ CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
JMFF026H22+ CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
JMFF002L06+ CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
JMFN040G02+ CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
JMFF038F19+ CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
JMFF030P15+ CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
rJMFF004P06- CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
JMFF004P06+ CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
JMFF020P08+ CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
rJMFF020P08- CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
                      ____________________________________________________________
consensus CACCGGTGCACATTAAGCGGTGCTCATTCTTCCAATAGATATCAAGAAGCTGGAAAGCGG
 
. : . : . : . : . : . :
JMFN038G21+ CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
rJMFF026H22- CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
rJMFF038F19- CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
rJMSF031L24- CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
JMSF031L24+ CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
rJMFF030P15- CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
JMFN039J10+ CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
JMFN005P12+ CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
JMFF026H22+ CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
JMFF002L06+ CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
JMFN040G02+ CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
JMFF038F19+ CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
JMFF030P15+ CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
rJMFF004P06- CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
JMFF004P06+ CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
JMFF020P08+ CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
rJMFF020P08- CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
                      ____________________________________________________________
consensus CGAAGGGTACGATGAAAAGCGAAGGCTGAAGGGTTAGAGATATGAGAGAGACGATCCGCG
 
. : . : . : . : . : . :
JMFN038G21+ ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
rJMFF026H22- ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
rJMFF038F19- ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
rJMSF031L24- ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
JMSF031L24+ ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
rJMFF030P15- ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
JMFN039J10+ ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
JMFN005P12+ ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
JMFF026H22+ ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
JMFF002L06+ ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
JMFN040G02+ ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
JMFF038F19+ ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
JMFF030P15+ ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
rJMFF004P06- ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
JMFF004P06+ ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
JMFF020P08+ ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
rJMFF020P08- ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
                      ____________________________________________________________
consensus ATCGGAGAGGCTTCGGCGATGGAAGCGTGAGGAGAATAGCGATGGCGGCCTCCACTGCCA
 
. : . : . : . : . : . :
JMFN038G21+ CGGCGTACGTAAGAATTATCCACTGCAAAGCCATT
rJMFF026H22- CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCT
rJMFF038F19- CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCTAGCT
rJMSF031L24- CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCTAGCT
JMSF031L24+ CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCTAGCT
rJMFF030P15- CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCTAGCT
JMFN039J10+ CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTA
JMFN005P12+ CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTC
JMFF026H22+ CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCT
JMFF002L06+ CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCTAGCT
JMFN040G02+ CGGCGTACGTAAGAATTA
JMFF038F19+ CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCTAGCT
JMFF030P15+ CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCTAGCT
rJMFF004P06- CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCTAGCT
JMFF004P06+ CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCTAGCT
JMFF020P08+ CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCTAGCT
rJMFF020P08- CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCTAGCT
                      ____________________________________________________________
consensus CGGCGTACGTAAGAATTATCCACTGCAAAGCCATTGTTTTCTTCTCTGTATTCTCTAGCT
 
. : . : . : . : . : . :
rJMFF038F19- TTCTACTTTCTTAAT
rJMSF031L24- TTCTACTTTCTTAAT
JMSF031L24+ TTCTACTTTCTTAAT
rJMFF030P15- TTCTACTTTCTTAAT
JMFF002L06+ TTCTACTTTCTT
JMFF038F19+ TTCTACTTTCTTAAT
JMFF030P15+ TTCTACTTTCTTAAT
rJMFF004P06- TTCTACTTTCTTAATATCGCTGTATTTTTCACTTCTCTTTCTTAAT
JMFF004P06+ TTCTACTTTCTTAATATCGCTGTATTTTTCACTTCTCTTTCTTAAT
JMFF020P08+ TTCTACTTTCTTAATATCGCTGTATTTTTCACTTCTCTTTCTTAAT
rJMFF020P08- TTCTACTTTCTTAATATCGCTGTATTTTTCACTTCTCTTTCTTAATCGGTTCTCGACGAA
                      ____________________________________________________________
consensus TTCTACTTTCTTAATATCGCTGTATTTTTCACTTCTCTTTCTTAATCGGTTCTCGACGAA