Previous Contig 009187:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020O20Sequence563003741 (95)736009187 (3)gb:AP004667_18429663e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P043
JMFF035O03Sequence556003741 (95)712009187 (3)gb:AP004667_18429663e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P043
JMSF047L11Sequence642007802 (4)gb:AY074284_15674443e-07Arabidopsis thaliana unknown protein (At1g60210) mRNA, complete cds.>gb:BT001972723009187 (3)gb:AP004667_18429663e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P043

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF047L11+ TTTCTGAAGCACCCTA
rJMFF020O20+ TTTCTGAAGCACCCTA
                      ____________________________________________________________
consensus TTTCTGAAGCACCCTA
 
. : . : . : . : . : . :
rJMSF047L11+ TTTGATCTCAACTACAGCAATAGAAACTGCAAAACGTATTTCTAATGTTAACTCTAAAGA
rJMFF035O03+ TCAACTACAGCAATAGAAACTGCAAAACGTATTTNTAATGTTAACTCTAAAGA
rJMFF020O20+ TTTGATCTCAACTACAGCAATAGAAACTGCAAAACGTATTTCTAATGTTAACTCTAAAGA
                      ____________________________________________________________
consensus TTTGATCTCAACTACAGCAATAGAAACTGCAAAACGTATTTCTAATGTTAACTCTAAAGA
 
. : . : . : . : . : . :
rJMSF047L11+ GGATAGGCTGGATGCAGAAAAGGATAGAAGTAGAAGGTCTCATGAAAGATCTAGTCATCG
rJMFF035O03+ GGATAGGCTGGATGCAGAAAAGGATAGAAGCAGAAGGTCTCATGAAAGATCTAGTCATCG
rJMFF020O20+ GGATAGGCTGGATGCAGAAAAGGATAGAAGCAGAAGGTCTCATGAAAGATCTAGTCATCG
                      ____________________________________________________________
consensus GGATAGGCTGGATGCAGAAAAGGATAGAAGCAGAAGGTCTCATGAAAGATCTAGTCATCG
 
. : . : . : . : . : . :
rJMSF047L11+ GGAACGTGAAAGGCATGATGAAGAGAGCCGAAAGGAAAATGTTGACCATGACCGAGCTCG
rJMFF035O03+ GGAACGTGAAAGGCATGATGAAGAGAGCCGAAAGGAAAATGTTGACCATGACCGAGCTCG
rJMFF020O20+ GGAACGTGAAAGGCATGATGAAGAGAGCCGAAAGGAAAATGTTGACCATGACCGAGCTCG
                      ____________________________________________________________
consensus GGAACGTGAAAGGCATGATGAAGAGAGCCGAAAGGAAAATGTTGACCATGACCGAGCTCG
 
. : . : . : . : . : . :
rJMSF047L11+ GGAACATAGGCCTGAAAAAACGCGGACTCCAGATAATCAGAAGCTTTTAGATGCAAAACA
rJMFF035O03+ GGAACATAGGCCTGAAAAAACGCGGACTCCAGATAATCAGAAGCTTTTAGATGCAAAACA
rJMFF020O20+ GGAACATAGGCCTGAAAAAACGCGGACTCCAGATAATCAGAAGCTTTTAGATGCAAAACA
                      ____________________________________________________________
consensus GGAACATAGGCCTGAAAAAACGCGGACTCCAGATAATCAGAAGCTTTTAGATGCAAAACA
 
. : . : . : . : . : . :
rJMSF047L11+ ACTGATCGATATGATTCCAAAGACTAAAAATGAGTTGTTTTCGTACGAGATAAATTGGGC
rJMFF035O03+ ACTGATCGATATGATTCCAAAGACTAAAAATGAGTTGTTTTCGTACGAGATAAATTGGGC
rJMFF020O20+ ACTGATCGATATGATTCCAAAGACTAAAAATGAGTTGTTTTCGTACGAGATAAATTGGGC
                      ____________________________________________________________
consensus ACTGATCGATATGATTCCAAAGACTAAAAATGAGTTGTTTTCGTACGAGATAAATTGGGC
 
. : . : . : . : . : . :
rJMSF047L11+ TATCTATGACAAGAATGAACTGCATGAGAGAATGAGGCCATGGATTGCTAAGAAGATTAC
rJMFF035O03+ TATCTATGACAAGAATGAACTGCATGAGAGAATGAGGCCATGGATTGCTAAGAAGATTAC
rJMFF020O20+ TATCTATGACAAGAATGAACTGCATGAGAGAATGAGGCCATGGATTGCTAAGAAGATTAC
                      ____________________________________________________________
consensus TATCTATGACAAGAATGAACTGCATGAGAGAATGAGGCCATGGATTGCTAAGAAGATTAC
 
. : . : . : . : . : . :
rJMSF047L11+ AGAATTTCTGGGAGAGGAGGAACCCACATTGGTAGACTATATAGTCTCCAGCACTCAAGA
rJMFF035O03+ AGAATTTCTGGGAGAGGAGGAACCCACATTGGTAGACTATATAGTCTCCAGCACTCAAGA
rJMFF020O20+ AGAATTTCTGGGAGAGGAGGAACCCACATTGGTAGACTATATAGTCTCCAGCACTCAAGA
                      ____________________________________________________________
consensus AGAATTTCTGGGAGAGGAGGAACCCACATTGGTAGACTATATAGTCTCCAGCACTCAAGA
 
. : . : . : . : . : . :
rJMSF047L11+ ACACGTGAAGGCGGCTGAGATGCTGGAGAGACTGCAAGCAATATTAGATGAAGAAGCCGA
rJMFF035O03+ ACACGTGAAGGCGGCTGAGATGCTGGAGAGACTGCAAGCAATATTAGATGAAGAAGCCGA
rJMFF020O20+ ACACGTGAAGGCGGCTGAGATGCTGGAGAGACTGCAAGCAATATTAGATGAAGAAGCCGA
                      ____________________________________________________________
consensus ACACGTGAAGGCGGCTGAGATGCTGGAGAGACTGCAAGCAATATTAGATGAAGAAGCCGA
 
. : . : . : . : . : . :
rJMSF047L11+ AATGTTTGTTTTGAAGATGTGGAGGATGCTCATCTTTGAAGTCAAGAAAGTTGAAACTGG
rJMFF035O03+ AATGTTTGTTTTGAAGATGTGGAGGATGCTCATCTTTGAAGTCAAGAAAGTTGAAACTGG
rJMFF020O20+ AATGTTTGTTTTGAAGATGTGGAGGATGCTCATCTTTGAAGTCAAGAAAGTTGAAACTGG
                      ____________________________________________________________
consensus AATGTTTGTTTTGAAGATGTGGAGGATGCTCATCTTTGAAGTCAAGAAAGTTGAAACTGG
 
. : . : . : . : . : . :
rJMSF047L11+ TTTGGCTTCCAGGTCTAAGTCTTAATTTTGTTTCCTGTTTATTTTCATATCATGTTTGTT
rJMFF035O03+ TTTGGCTTCCAGGTCTAAGTCTTAATTTTGTTTCCTGTTTATTTTCATATCATGTTTGTT
rJMFF020O20+ TTTGGCTTCCAGGTCTAAGTCTTAATTTTGTTTCCTGTTTATTTTCATATCATGTTTGTT
                      ____________________________________________________________
consensus TTTGGCTTCCAGGTCTAAGTCTTAATTTTGTTTCCTGTTTATTTTCATATCATGTTTGTT
 
. : . : . : . : . : . :
rJMSF047L11+ GTCTTGGAGCCATATCTCTGTGTACTAGTATTTTCCTTTCTTTTTTGCCCCCTNGACTCC
rJMFF035O03+ GTCTTGGAGCCATATCTCTGTGTACTAGTATTTTCCTTTCTTTTTTGCCCCCTTGACTCC
rJMFF020O20+ GTCTTGGAGCCATATCTCTGTGTACTAGTATTTTCCTTTCTTTTTTGCCCCCTTGACTCC
                      ____________________________________________________________
consensus GTCTTGGAGCCATATCTCTGTGTACTAGTATTTTCCTTTCTTTTTTGCCCCCTTGACTCC
 
. : . : . : . : . : . :
rJMSF047L11+ TGGAAAATCACATTGCTACAGGACCTAAATGATGGANAACACAATAA
rJMFF035O03+ TGGAAAATCACATTGCTACAGGACCTAAATGATGGAAAACACAATAATACTTGCTCATT
rJMFF020O20+ TGGAAAATCACATTGCTACAGGACCTAAATGATGGAAAACACAATAATACTTGCTCATTT
                      ____________________________________________________________
consensus TGGAAAATCACATTGCTACAGGACCTAAATGATGGAAAACACAATAATACTTGCTCATTT