Previous Contig 009185:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020O13Sequence475009185 (2)pir|T10586|T105868e-31small nuclear ribonucleoprotein-associated protein homolog F9F13.90 - Arabidopsi615009185 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF020O13- ACTCTTCCATCGTAATGCCATAAAGAAACCCTAATACCTAAACC
                      ____________________________________________________________
consensus ACTCTTCCATCGTAATGCCATAAAGAAACCCTAATACCTAAACC
 
. : . : . : . : . : . :
JMFF020O13- CCTCCGGCCGTCTCTTAAAGCCCCACTTTCCAGGCGGAACCTTGGCCGGTCTTCTCTTTC
                      ____________________________________________________________
consensus CCTCCGGCCGTCTCTTAAAGCCCCACTTTCCAGGCGGAACCTTGGCCGGTCTTCTCTTTC
 
. : . : . : . : . : . :
JMFF020O13- GGATCCAGCCAAGATGTCGATGTCGAAAACTTCCAAGATGCTTCAATACATCAATTATCG
                      ____________________________________________________________
consensus GGATCCAGCCAAGATGTCGATGTCGAAAACTTCCAAGATGCTTCAATACATCAATTATCG
 
. : . : . : . : . : . :
JMFF020O13- GATTCGGGTCACGGTCCAGGACGGCCGTCAGTTGGTCGGAAAATTCATGGCTTTCGATCG
                      ____________________________________________________________
consensus GATTCGGGTCACGGTCCAGGACGGCCGTCAGTTGGTCGGAAAATTCATGGCTTTCGATCG
 
. : . : . : . : . : . :
JMFF020O13- CCACATGAACCTCGTTCTCGGAGATTGCGAGGAGTTCCGGAAGCTTCCACTGACTAAGGG
                      ____________________________________________________________
consensus CCACATGAACCTCGTTCTCGGAGATTGCGAGGAGTTCCGGAAGCTTCCACTGACTAAGGG
 
. : . : . : . : . : . :
JMFF020O13- CTCGAAAGAAGAGCGCGAGGATCGCCGCACTCTCGGCCTTCTCCTCCTCCGTGGCGAAGA
                      ____________________________________________________________
consensus CTCGAAAGAAGAGCGCGAGGATCGCCGCACTCTCGGCCTTCTCCTCCTCCGTGGCGAAGA
 
. : . : . : . : . : . :
JMFF020O13- AGTTATCTCCATGACCGTTGAGGGTCCGCCTCCTCCCGATGAATCCCGCGTCAAGGCAAC
rJMFF020O13+ CCGCGTCAAGGCAAN
                      ____________________________________________________________
consensus AGTTATCTCCATGACCGTTGAGGGTCCGCCTCCTCCCGATGAATCCCGCGTCAAGGCAAC
 
. : . : . : . : . : . :
JMFF020O13- TGGAGCTGCAAATGGCGTT-CCCGGGCCCGGTATTGGTCGTGGCGCTGGGAGAGGGGTTC
rJMFF020O13+ TGGAGCTGCAAATGGCGTTCCCCGGGCCCGGTATTGGTCGTGGCGCTGGGAGAGGGGTTC
                      ____________________________________________________________
consensus TGGAGCTGCAAATGGCGTTCCCCGGGCCCGGTATTGGTCGTGGCGCTGGGAGAGGGGTTC
 
. : . : . : . : . : . :
JMFF020O13- C
rJMFF020O13+ NTACCGGGCCGTTGGTTCAGGCCCAGCCCGGACTTTNTGGTCCGGTTCGCGGTGTTGGTG
                      ____________________________________________________________
consensus CTACCGGGCCGTTGGTTCAGGCCCAGCCCGGACTTTNTGGTCCGGTTCGCGGTGTTGGTG
 
. : . : . : . : . : . :
rJMFF020O13+ GGCCCGCTCCGGGAATGATGCAACCTCAGATCTCTCGTCCTCCGATAAACTACCCTCAGC
                      ____________________________________________________________
consensus GGCCCGCTCCGGGAATGATGCAACCTCAGATCTCTCGTCCTCCGATAAACTACCCTCAGC
 
. : . : . : . : . : . :
rJMFF020O13+ AACCGCCTGTGATGAGGCCACCCGGTGGTGGACCGCCGGTGGCTCCTCCACCGCAGCCCT
                      ____________________________________________________________
consensus AACCGCCTGTGATGAGGCCACCCGGTGGTGGACCGCCGGTGGCTCCTCCACCGCAGCCCT
 
. : . : . : . : . : . :
rJMFF020O13+ TGATGGCAGCGCCGCAGCAGTTCCGACCACTTCCTCCAGGGCAATTCCCGCCGCAGTTTG
                      ____________________________________________________________
consensus TGATGGCAGCGCCGCAGCAGTTCCGACCACTTCCTCCAGGGCAATTCCCGCCGCAGTTTG
 
. : . : . : . : . : . :
rJMFF020O13+ GGCAGCGGCCTATGATGCCGCCTCCTCCTATGATGAGAGGTCCACCTCCTCCCGGAGCTC
                      ____________________________________________________________
consensus GGCAGCGGCCTATGATGCCGCCTCCTCCTATGATGAGAGGTCCACCTCCTCCCGGAGCTC
 
. : . : . : . : . : . :
rJMFF020O13+ CGCCGAGGCCCAATATGCCTGGTGGTGGCCCACCTGGACAGCCTCCTCGCCCTGGGATGC
                      ____________________________________________________________
consensus CGCCGAGGCCCAATATGCCTGGTGGTGGCCCACCTGGACAGCCTCCTCGCCCTGGGATGC
 
. : . : . : . : . : . :
rJMFF020O13+ CGCCTCCACCTCCTGGTGGTCAATTTCCTGTCTTTGGACCTCCCCGTCCGGGAATGCCGC
                      ____________________________________________________________
consensus CGCCTCCACCTCCTGGTGGTCAATTTCCTGTCTTTGGACCTCCCCGTCCGGGAATGCCGC
 
. : . : . : . : . : . :
rJMFF020O13+ CCCCACAGAATCAGTAGTTGTGGGATTCAGTATGTACAACCGAATCTTCTATCTTTATTG
                      ____________________________________________________________
consensus CCCCACAGAATCAGTAGTTGTGGGATTCAGTATGTACAACCGAATCTTCTATCTTTATTG
 
. : . : . : . : . : . :
rJMFF020O13+ CTTCGAATTCTCCTGTTGATGTTTCTGTTGTATTTGTTTTATTGGTGATAATTAAACCTT
                      ____________________________________________________________
consensus CTTCGAATTCTCCTGTTGATGTTTCTGTTGTATTTGTTTTATTGGTGATAATTAAACCTT