Previous Contig 009182:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020N23Sequence567009182 (2)pir|G86255|G862551e-37protein F12F1.7 [imported] - Arabidopsis thaliana>gb:AE005172_890221 Arabidopsis664009182 (2)pir|G86255|G862552e-37protein F12F1.7 [imported] - Arabidopsis thaliana>gb:AE005172_890221 Arabidopsis

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF020N23- CATC
rJMFF020N23+ CATC
                      ____________________________________________________________
consensus CATC
 
. : . : . : . : . : . :
JMFF020N23- CGCCGTTAAGATACAGTCGGCTTACCGCTCTCACGTGGTCCGCAAGCTCGTCAAGAAGAT
rJMFF020N23+ CGCCGTTAAGATACAGTCGGCTTACCGCTCTCACGTGGTCCGCAAGCTCGTCAAGAAGAT
                      ____________________________________________________________
consensus CGCCGTTAAGATACAGTCGGCTTACCGCTCTCACGTGGTCCGCAAGCTCGTCAAGAAGAT
 
. : . : . : . : . : . :
JMFF020N23- CTCGGCCGTCAATCGCGAAGCTAACTATCTCCAACGCCTCATCCAACTCCAGGAGACGGT
rJMFF020N23+ CTCGGCCGTCAATCGCGAAGCTAACTATCTCCAACGCCTCATCCAACTCCAGGAGACGGT
                      ____________________________________________________________
consensus CTCGGCCGTCAATCGCGAAGCTAACTATCTCCAACGCCTCATCCAACTCCAGGAGACGGT
 
. : . : . : . : . : . :
JMFF020N23- TGATGCTGTGAGAAGCAACGAGCGGGAGAGGATCAGAATCAACGAAGCATTGATGGGATT
rJMFF020N23+ TGATGCTGTGAGAAGCAACGAGCGGGAGAGGATCAGAATCAACGAAGCATTGATGGGATT
                      ____________________________________________________________
consensus TGATGCTGTGAGAAGCAACGAGCGGGAGAGGATCAGAATCAACGAAGCATTGATGGGATT
 
. : . : . : . : . : . :
JMFF020N23- ACTGTTCAGATTAGACTCTGTTCCCGGTGTTGATCCAACGGTCAGGGACTTGAGGCGACA
rJMFF020N23+ ACTGTTCAGATTAGACTCTGTTCCCGGTGTTGATCCAACGGTCAGGGACTTGAGGCGACA
                      ____________________________________________________________
consensus ACTGTTCAGATTAGACTCTGTTCCCGGTGTTGATCCAACGGTCAGGGACTTGAGGCGACA
 
. : . : . : . : . : . :
JMFF020N23- TGTTAGCCGGAGGATCGTAGGGTTGCAGGAGATACTGGATGCGGTTTCGGATGCCAAAAT
rJMFF020N23+ TGTTAGCCGGAGGATCGTAGGGTTGCAGGAGATACTGGATGCGGTTTCGGATGCCAAAAT
                      ____________________________________________________________
consensus TGTTAGCCGGAGGATCGTAGGGTTGCAGGAGATACTGGATGCGGTTTCGGATGCCAAAAT
 
. : . : . : . : . : . :
JMFF020N23- CGAAAGTTGGGACGGTTTCTTGAGGGACTGGGATGATGTTCTCGAGAAAATCGAGAGCGA
rJMFF020N23+ CGAAAGTTGGGACGGTTTCTTGAGGGACTGGGATGATGTTCTCGAGAAAATCGAGAGCGA
                      ____________________________________________________________
consensus CGAAAGTTGGGACGGTTTCTTGAGGGACTGGGATGATGTTCTCGAGAAAATCGAGAGCGA
 
. : . : . : . : . : . :
JMFF020N23- AGTTTGCAAGGAAAGAGGGAATGGAGATCTGGAGAGGTTTTGTGCTGAGCATTTGGGATT
rJMFF020N23+ AGTTTGCAAGGAAAGAGGGAATGGAGATCTGGAGAGGTTTTGTGCTGAGCATTTGGGATT
                      ____________________________________________________________
consensus AGTTTGCAAGGAAAGAGGGAATGGAGATCTGGAGAGGTTTTGTGCTGAGCATTTGGGATT
 
. : . : . : . : . : . :
JMFF020N23- TCGATGCCTTCAACAGTTTCTTCGTGATAACTGATAAGTTTAATGGTGTTCTATCTCTCT
rJMFF020N23+ TCGATGCCTTCAACAGTTTCTTCGTGATAACTGATAAGTTTAATGGTGTTCTATCTCTCT
                      ____________________________________________________________
consensus TCGATGCCTTCAACAGTTTCTTCGTGATAACTGATAAGTTTAATGGTGTTCTATCTCTCT
 
. : . : . : . : . : . :
JMFF020N23- ATATAATATATATATATATATGCACACTTCTTATAGATCCACTACCAGAACTAAACTGCC
rJMFF020N23+ ATATAATATATATATATATATGCACACTTCTTATAGATCCACTACCAGAACTAAACTGCC
                      ____________________________________________________________
consensus ATATAATATATATATATATATGCACACTTCTTATAGATCCACTACCAGAACTAAACTGCC
 
. : . : . : . : . : . :
JMFF020N23- TTAGCTTGCTTTCTGTATATATT
rJMFF020N23+ TTAGCTTGCTTTCTGTATATATTACAATACAAAAAAAATAGAATTGTGAGTAGATATGCC
                      ____________________________________________________________
consensus TTAGCTTGCTTTCTGTATATATTACAATACAAAAAAAATAGAATTGTGAGTAGATATGCC
 
. : . : . : . : . : . :
rJMFF020N23+ TTATGGCCTGGATATCATTTTGCTTTTATTATTCGACTCTAAGTTGTCTGGCATAGTGAC
                      ____________________________________________________________
consensus TTATGGCCTGGATATCATTTTGCTTTTATTATTCGACTCTAAGTTGTCTGGCATAGTGAC