Previous Contig 009177:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018B09Sequence587009177 (6)gb:AX007155_14562512e-85Sequence 1 from Patent WO0000626.>gb:AF346431_1789952 Nicotiana tabacum phenylpr692010782 (4)pir|T03747|T037472e-62glucosyltransferase IS5a (EC 2.4.1.-), salicylate-induced - common tobacco>gb:NT
JMFF020M24Sequence548002159 (4)pir|T03747|T037473e-55glucosyltransferase IS5a (EC 2.4.1.-), salicylate-induced - common tobacco>gb:NT721009177 (6)gb:LETWI1_16846841e-22L.esculentum twi1 mRNA.
JMFF027C16Sequence486002159 (4)pir|T03747|T037472e-50glucosyltransferase IS5a (EC 2.4.1.-), salicylate-induced - common tobacco>gb:NT648009177 (6)gb:LETWI1_16846843e-36L.esculentum twi1 mRNA.
JMFF047E15Sequence513010782 (4)pir|T03747|T037478e-47glucosyltransferase IS5a (EC 2.4.1.-), salicylate-induced - common tobacco>gb:NT420009177 (6)gb:AX007155_14562518e-17Sequence 1 from Patent WO0000626.>gb:AF346431_1789952 Nicotiana tabacum phenylpr
JMFF047O03Sequence534009177 (6)gb:AX007155_14562515e-73Sequence 1 from Patent WO0000626.>gb:AF346431_1789952 Nicotiana tabacum phenylpr499010782 (4)pir|T03747|T037479e-18glucosyltransferase IS5a (EC 2.4.1.-), salicylate-induced - common tobacco>gb:NT
JMSF005K08Sequence309002159 (4)pir|T03747|T037475e-32glucosyltransferase IS5a (EC 2.4.1.-), salicylate-induced - common tobacco>gb:NT114009177 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF018B09+ TTCAACAAGGACGC
                      ____________________________________________________________
consensus TTCAACAAGGACGC
 
. : . : . : . : . : . :
JMFF018B09+ AGAAGATAAAGCTGAAAGAGGGAAGAAATCGGCAATCGACGAGCATGAATGCCTGAAATG
JMFF047O03+ GAAATG
                      ____________________________________________________________
consensus AGAAGATAAAGCTGAAAGAGGGAAGAAATCGGCAATCGACGAGCATGAATGCCTGAAATG
 
. : . : . : . : . : . :
JMFF018B09+ GCTGGATTCCAAGAACCCCCATTCCGTGGTTTATATCTGTTTCGGAAGCGTCGCAAATTT
JMFF047O03+ GCT-GATTCCAAGAACCCCCATTCCGTGGTTTATATCTGTTTCGGAAGCGTCGCAAATTT
                      ____________________________________________________________
consensus GCTGGATTCCAAGAACCCCCATTCCGTGGTTTATATCTGTTTCGGAAGCGTCGCAAATTT
 
. : . : . : . : . : . :
JMFF018B09+ CGCTCCATCTCAGCTCCACGAAATGGCGATGGGGATCGAGGATTCAGGGCTGGACTTCGT
JMFF047O03+ CGCTCCATCTCAGCTCCACGAAATGGCGATGGGGATCGAGGATTCAGGGCTGGACTTCGT
                      ____________________________________________________________
consensus CGCTCCATCTCAGCTCCACGAAATGGCGATGGGGATCGAGGATTCAGGGCTGGACTTCGT
 
. : . : . : . : . : . :
JMFF018B09+ GTGGGTGATCAGAAACAAGAGAGAAGAAGAGAAATGGATGCCGGAAGGATTCGAGGAGAG
JMFF047O03+ GTGGGTGATCAGAAACAAGAGAGAAGAAGAGAAATGGATGCCGGAAGGATTCGAGGAGAG
                      ____________________________________________________________
consensus GTGGGTGATCAGAAACAAGAGAGAAGAAGAGAAATGGATGCCGGAAGGATTCGAGGAGAG
 
. : . : . : . : . : . :
JMFF018B09+ AACCAAAGGGAAAGGATTGATCATAAGAGGCTGGGCTCCCCAAGTTCTAATTCTTGATCA
JMFF047O03+ AACCAAAGGGAAAGGATTGATCATAAGAGGCTGGGCTCCCCAAGTTCTAATTCTTGATCA
rJMFF027C16+ ATCA
                      ____________________________________________________________
consensus AACCAAAGGGAAAGGATTGATCATAAGAGGCTGGGCTCCCCAAGTTCTAATTCTTGATCA
 
. : . : . : . : . : . :
JMFF018B09+ CGAATCCCTGGGAGCATTCGTGACCCATTGTGGATGGAACTCGACTCTGGAAGCTCTGTG
JMFF047O03+ CGAATCCCTGGGAGCATTCGTGACCCATTGTGGATGGAACTCGACTCTGGAAGCTCTGTG
rJMFF027C16+ CGAAGCCGTGGGAGCATTCGTGACCCATTGCGGATGGAACTCAACGTTGGAAGGGATATC
                      ____________________________________________________________
consensus CGAATCCCTGGGAGCATTCGTGACCCATTGTGGATGGAACTCGACTCTGGAAGCTCTGTG
 
. : . : . : . : . : . :
JMFF018B09+ TGCGGGTGTGCCCATGGTGACATGGCCGCTATTCGCCGAGCAGTTCGTGAATGAGAAACT
JMFF047O03+ TGCGGGTGTGCCCATGGTGACATGGCCGCTATTCGCCGAGCAGTTCGTGAATGAGAAACT
rJMFF027C16+ TGCAGGGGTGCCCATGGTGACATGGCCGGTGTTCGCCGAACAGTTCTTGAATGAAAAACT
rJMFF020M24+ GTGCCCATGGTGACATGGCCGGTGTTCGCCGAACAGTTCTTGAATGAAAAACT
                      ____________________________________________________________
consensus TGCGGGTGTGCCCATGGTGACATGGCCGGTGTTCGCCGAGCAGTTCTTGAATGAGAAACT
 
. : . : . : . : . : . :
JMFF018B09+ CATGACTGACATTTTGCAGACCGGAATCGGAGTTGGGTCGAAAGAGTGGAAGATATCAGG
JMFF047O03+ CATGACTGACATTTTGCAGACCGGAATCGGAGTTGGGTCGAAAGAGTGGAAGATATCAGG
rJMFF027C16+ GATGACTGATGTTCTGCGGACAGGAACCGGAGTTGGGTCGAAAGAGTGGAAGAGATCAGA
rJMFF047E15+ GACTGAGATTTTGCTGACCGGAATCGGGGTTGGGTCGATAGAGTGGAAGGAATCCGA
rJMFF020M24+ GATGACTGATGTTCTGCGGACAGGAACCGGAGTTGGGTCGAAAGAGTGGAAGAGATCAGA
                      ____________________________________________________________
consensus GATGACTGATATTTTGCGGACCGGAATCGGAGTTGGGTCGAAAGAGTGGAAGATATCAGA
 
. : . : . : . : . : . :
JMFF018B09+ CAACGATGGTGTGAAGAGAGAAGCCATTAGAGAGGCAATCAAGAAAGTGATGATCAGTGA
JMFF047O03+ CAACGATGGTGTGAAGAGAGAAGCCATTAGAGAGGCAATCAAGAAAGTGATGATCAGTGA
rJMFF027C16+ GAGTGACGGTGTGAAGAGGGAAGCCATTGCAGAGGCAATGAAGAAGGTGATGATCGGTGA
rJMFF047E15+ GAGTGATGGTGTGAAAAGAGAAGCCATTGCAGAGGCAATGAAGAGAGTGATGATGAGTGA
rJMSF005K08+ TTGCAGAGGCNATCAAGAAGGTGATGATCGGTGA
rJMFF020M24+ GAGTGACGGTGTGAAGAGGGAAGCCATTGCAGAGGCAATGAAGAAGGTGATGATCGGTGA
                      ____________________________________________________________
consensus GAGTGATGGTGTGAAGAGAGAAGCCATTGCAGAGGCAATGAAGAAGGTGATGATCGGTGA
 
. : . : . : . : . : . :
JMFF018B09+ GGAATCGGAGGAGATGAGGAACAGAGCAAAGGC
JMFF047O03+ GGAATCGGAGGAGATGAGGAACAGAGCAAAGGCAATGAAAGACAAGGC
rJMFF027C16+ AGAATCAGAGGAGATTCGGAGCAGAGCAAAGGCAATGAAAGACAAGGCAAAGAAGGCAAT
rJMFF047E15+ AGAATCGGAGGAGATGAGGAGCAGATCAAAGGCAATGAAAGACAAGGCAAAGAAGGCAAT
rJMSF005K08+ AGAATCTGAGGAGATGAGGNGCNGNGCAAAGGTGATGAAAGATAAGGCGAAGAAGGCNAT
rJMFF020M24+ AGAATCAGAGGAGATTCGGAGCAGAGCAAAGGCAATGAAAGACAAGGCAAAGAAGGCAAT
                      ____________________________________________________________
consensus AGAATCGGAGGAGATGAGGAGCAGAGCAAAGGCAATGAAAGACAAGGCAAAGAAGGCAAT
 
. : . : . : . : . : . :
rJMFF027C16+ CGAGGAAGGAGGATCATCTTACTTAGGCTTGAGCTCTTTGTTAGATGAACTCAGAGCTTA
rJMFF047E15+ CGAAGAAGGAGGATCATCTTACGTAGACTTGGGCTCTTTGTTGGATGAATTGAGAGCTTA
rJMSF005K08+ TGAGGAAGGAGGATCAT
rJMFF020M24+ CGAGGAAGGAGGATCATCTTACTTAGGCTTGAGCTCTTTGTTAGATGAACTCAGAGCTTA
                      ____________________________________________________________
consensus CGAGGAAGGAGGATCATCTTACTTAGGCTTGAGCTCTTTGTTAGATGAACTCAGAGCTTA
 
. : . : . : . : . : . :
rJMFF027C16+ CCATGCAAAACATTGACTACATCTACAAGGTCCTAAAACATTGAAGATTTCAGTACGAGG
rJMFF047E15+ CCATACAAAACATT
rJMFF020M24+ CCATGCAAAACATTGACTACATCTACAAGGTCCTAAAACATTGAAGATTTCAGTACGAGG
                      ____________________________________________________________
consensus CCATGCAAAACATTGACTACATCTACAAGGTCCTAAAACATTGAAGATTTCAGTACGAGG
 
. : . : . : . : . : . :
rJMFF027C16+ TCTACAGTTTACCTGTCTGGTTTTCTCAATTCTTTCTGCATTTTCTTCACACCCTTTGTA
rJMFF020M24+ TCTACAGTTTACCTGTCTGGTTTTCTCAATTCTTTCTGCATTTTCTTCACACCCTTTGTA
                      ____________________________________________________________
consensus TCTACAGTTTACCTGTCTGGTTTTCTCAATTCTTTCTGCATTTTCTTCACACCCTTTGTA
 
. : . : . : . : . : . :
rJMFF027C16+ GGGGTAGAATCTGGATAATCACAAATAAATATGAATTACCCTTTAGTTTGAGGAATGGAG
rJMFF020M24+ GGGGTAGAATCTGGATAATCACAAATAAATATGAATTACCCTTTAGTTTGAGGAATGGAG
                      ____________________________________________________________
consensus GGGGTAGAATCTGGATAATCACAAATAAATATGAATTACCCTTTAGTTTGAGGAATGGAG
 
. : . : . : . : . : . :
rJMFF027C16+ TTCCATTATACCAACATTTACGGGTGAGTTCCAAATCCACGGAATGGGAGCATGCTATAT
rJMFF020M24+ TTCCATTATACCAACATTTACGGGTGAGTTCCAAATCCACGGAATGGGAGCATGCTATAT
                      ____________________________________________________________
consensus TTCCATTATACCAACATTTACGGGTGAGTTCCAAATCCACGGAATGGGAGCATGCTATAT
 
. : . : . : . : . : . :
rJMFF027C16+ AAATTTGTTCACTGGATGTTGTGTTCTTCATCTGGAAATCTTTA
rJMFF020M24+ AAATTTGTTCACTGGATGTTGTGTTCTTCATCTGGAAATCTTTATGTGGGCAATTTTTTT
                      ____________________________________________________________
consensus AAATTTGTTCACTGGATGTTGTGTTCTTCATCTGGAAATCTTTATGTGGGCAATTTTTTT
 
. : . : . : . : . : . :
rJMFF020M24+ ATGGTAATGTTGTGTTGACCAGACCAGTTGCTTCTCTACTATGATATGATCTCTTCTTTG
                      ____________________________________________________________
consensus ATGGTAATGTTGTGTTGACCAGACCAGTTGCTTCTCTACTATGATATGATCTCTTCTTTG
 
. : . : . : . : . : . :
rJMFF020M24+ TAGGGTTTAAGGAACTTCCCATGATCTTCTGTTTATTANTGTTTAACACAGAAATCAGAA
                      ____________________________________________________________
consensus TAGGGTTTAAGGAACTTCCCATGATCTTCTGTTTATTANTGTTTAACACAGAAATCAGAA