Previous Contig 009168:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007F23Sequence534009168 (6)gb:AK176667_18186556e-16Arabidopsis thaliana mRNA for putative glycerate dehydrogenase, complete cds, cl737009168 (6)gb:AE005172_8902666e-52Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025416_153947
JMFF020J22Sequence563009168 (6)gb:AK176667_18186555e-17Arabidopsis thaliana mRNA for putative glycerate dehydrogenase, complete cds, cl681009168 (6)gb:AE005172_8902666e-48Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025416_153947
JMSF022C08Sequence637009168 (6)gb:AK176904_18188926e-38Arabidopsis thaliana mRNA for putative glycerate dehydrogenase, partial cds, clo737009168 (6)gb:AE005172_8902663e-53Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025416_153947

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF020J22- ATGTGACCTTAT
JMFF007F23- ATGTGACCTTAT
JMSF022C08- GATGTGACCTTAT
                      ____________________________________________________________
consensus GATGTGACCTTAT
 
. : . : . : . : . : . :
JMFF020J22- TCCGAATGGTAGACGTCAATTTCAACCCTAAGAAACATATTTACCTCGCATCCAGTCGCC
JMFF007F23- TCCGAATGGTAGACGTCAATTTCAACCCTAAGAAACATATTTACCTCGCATCCAGTCGCC
JMSF022C08- TCCGAATGGTAGACGTCAATTTCAACCCTAAGAAACATATTTACCTCGCATCCAGTCGCC
                      ____________________________________________________________
consensus TCCGAATGGTAGACGTCAATTTCAACCCTAAGAAACATATTTACCTCGCATCCAGTCGCC
 
. : . : . : . : . : . :
JMFF020J22- GACGATGGATCTCCGGCGATCCGATCAAGGAAAAGAAGAACGTCCACAGCTGCTGGTTAT
JMFF007F23- GACGATGGATCTCCGGCGATCCGATCAAGGAAAAGAAGAACGTCCACAGCTGCTGGTTAT
JMSF022C08- GACGATGGATCTCCGGCGATCCGATCAAGGAAAAGAAGAACGTCCACAGCTGCTGGTTAT
                      ____________________________________________________________
consensus GACGATGGATCTCCGGCGATCCGATCAAGGAAAAGAAGAACGTCCACAGCTGCTGGTTAT
 
. : . : . : . : . : . :
JMFF020J22- AGTTCCATCATCTGTTTTCATTGTCCACGAACAACAATTCTGCGAAAGGTTTAACGTCCT
JMFF007F23- AGTTCCATCATCTGTTTTCATTGTCCACGAACAACAATTCTGCGAAAGGTTTAACGTCCT
JMSF022C08- AGTTCCATCATCTGTTTTCATTGTCCACGAACAACAATTCTGCGAAAGGTTTAACGTCCT
                      ____________________________________________________________
consensus AGTTCCATCATCTGTTTTCATTGTCCACGAACAACAATTCTGCGAAAGGTTTAACGTCCT
 
. : . : . : . : . : . :
JMFF020J22- CAAAGCTTACGAATCACCTCTGCCGACCGACGAGTTTCTGGAGACGAAAGCTCAATCCGC
JMFF007F23- CAAAGCTTACGAATCACCTCTGCCGACCGACGAGTTTCTGGAGACGAAAGCTCAATCCGC
JMSF022C08- CAAAGCTTACGAATCACCTCTGCCGACCGACGAGTTTCTGGAGACGAAAGCTCAATCCGC
                      ____________________________________________________________
consensus CAAAGCTTACGAATCACCTCTGCCGACCGACGAGTTTCTGGAGACGAAAGCTCAATCCGC
 
. : . : . : . : . : . :
JMFF020J22- TCAGGCCGTTATCTGCTTTGGAAAGAGCCCTATCACGGAGGCTGTGCTCCGTCTCCTCCC
JMFF007F23- TCAGGCCGTTATCTGCTTTGGAAAGAGCCCTATCACGGAGGCTGTGCTCCGTCTCCTCCC
JMSF022C08- TCAGGCCGTTATCTGCTTTGGAAAGAGCCCTATCACGGAGGCTGTGCTCCGTCTCCTCCC
                      ____________________________________________________________
consensus TCAGGCCGTTATCTGCTTTGGAAAGAGCCCTATCACGGAGGCTGTGCTCCGTCTCCTCCC
 
. : . : . : . : . : . :
JMFF020J22- CTCCCTGCGCCTCGTCGTCACCAGCGGCACCGGCGTCAACCACATCGATCTCCCCGAGTG
JMFF007F23- CTCCCTGCGCCTCGTCGTCACCAGCGGCACCGGCGTCAACCACATCGATCTCCCCGAGTG
JMSF022C08- CTCCCTGCGCCTCGTCGTCACCAGCGGCACCGGCGTCAACCACATCGATCTCCCCGAGTG
                      ____________________________________________________________
consensus CTCCCTGCGCCTCGTCGTCACCAGCGGCACCGGCGTCAACCACATCGATCTCCCCGAGTG
 
. : . : . : . : . : . :
JMFF020J22- CCGCCGCCGCGGAATCGCCGTCTGCAACACTTCTGATGTGTTCTCGGAAGACACAGCTGA
JMFF007F23- CCGCCGCCGCGGAATCGCCGTCTGCAACACTTCTGATGTGTTCTCGGAAGACACAGCTGA
JMSF022C08- CCGCCGCCGCGGAATCGCCGTCTGCAACACTTCTGATGTGTTCTCGGAAGACACAGCTGA
                      ____________________________________________________________
consensus CCGCCGCCGCGGAATCGCCGTCTGCAACACTTCTGATGTGTTCTCGGAAGACACAGCTGA
 
. : . : . : . : . : . :
JMFF020J22- CTACGCCGTCGGCCTCCCTCATCGACGTCCTCCGGAAAGTAAGCTACGGCGATCGATTTG
JMFF007F23- CTACGCCGTCGGCCTCCCTCATCGACGTCCTCCGGAAAGTAAGCTACGGCGATCGATTTG
JMSF022C08- CTACGCCGTCGGCCT-CCTCATCGACGTCCTCCGGAAAGTAAGCTACGGCGATCGATTT-
rJMSF022C08+ CTCCGGAAAGTAAGCTACGGCGATCGATTT-
rJMFF007F23+ GGAAAGTAAGCTACGGCGATCGATTT-
                      ____________________________________________________________
consensus CTACGCCGTCGGCCTCCCTCATCGACGTCCTCCGGAAAGTAAGCTACGGCGATCGATTT-
 
. : . : . : . : . : . :
JMFF020J22- GTTCGTCGCGGTGTCTGGCCCACCGTCGATAACTTCCCACCAGGTTTTCAGTTGGGAGGA
JMFF007F23- GTTCGTCGCGGTGTCTGGCCCACCGTCGATAACTTCCCACCA
JMSF022C08- GTTCGTCGCGGTGTCTGGCCCACCGTCGATAACTTCCCACCAGGTTTTCAGTTGGGAGGA
rJMSF022C08+ GTTCGTCGCGGTGTCTGGCCCACCGTCGATAACTTCCCACCAGGTTTTCAGTTGGGAGGA
rJMFF007F23+ GTTCGTCGCGGTGTCTGGCCCACCGTCGATAACTTCCCACCAGGTTTTCAGTTGGGAGGA
rJMFF020J22+ ACCAGGTTTTCAGTTGGGAGGA
                      ____________________________________________________________
consensus GTTCGTCGCGGTGTCTGGCCCACCGTCGATAACTTCCCACCAGGTTTTCAGTTGGGAGGA
 
. : . : . : . : . : . :
JMFF020J22- AAGCATGTGGG
JMSF022C08- AAGCATGTGGGGATTGTAGGGCTTGGCAACATAGGCTCCAAAGTTGCGAAAAGGCTCGAG
rJMSF022C08+ AAGCATGTGGGGATTGTAGGGCTTGGCAACATAGGCTCCAAAGTTGCGAAAAGGCTCGAG
rJMFF007F23+ AAGCATGTGGGGATTGTAGGGCTTGGCAACATAGGCTCCAAAGTTGCGAAAAGGCTCGAG
rJMFF020J22+ AAGCATGTGGGGATTGTAGGGCTTGGCAACATAGGCTCCAAAGTTGCGAAAAGGCTCGAG
                      ____________________________________________________________
consensus AAGCATGTGGGGATTGTAGGGCTTGGCAACATAGGCTCCAAAGTTGCGAAAAGGCTCGAG
 
. : . : . : . : . : . :
JMSF022C08- GCCTTTGGGTGCATTATATCCTACAA
rJMSF022C08+ GCCTTTGGGTGCATTATATCCTACAATTCAAGGCAGAAAAAGCCAGTGCCCTACACCTTC
rJMFF007F23+ GCCTTTGGGTGCATTATATCCTACAATTCAAGGCAGAAAAAGCCAGTGCCCTACACCTTC
rJMFF020J22+ GCCTTTGGGTGCATTATATCCTACAATTCAAGGCAGAAAAAGCCAGTGCCCTACACCTTC
                      ____________________________________________________________
consensus GCCTTTGGGTGCATTATATCCTACAATTCAAGGCAGAAAAAGCCAGTGCCCTACACCTTC
 
. : . : . : . : . : . :
rJMSF022C08+ TTCCCTGATGTCTGTGACCTTGCGGCCAACTGCAACATCCTCGTCCTCTGCTGTTCCTTA
rJMFF007F23+ TTCCCTGATGTCTGTGACCTTGCGGCCAACTGCAACATCCTCGTCCTCTGCTGTTCCTTA
rJMFF020J22+ TTCCCTGATGTCTGTGACCTTGCGGCCAACTGCAACATCCTCGTCCTCTGCTGTTCCTTA
                      ____________________________________________________________
consensus TTCCCTGATGTCTGTGACCTTGCGGCCAACTGCAACATCCTCGTCCTCTGCTGTTCCTTA
 
. : . : . : . : . : . :
rJMSF022C08+ ACACCTAAAACACGACACATGGTTAACAAACATGTCTTGGAAGCCCTGGGAAAGGACGGG
rJMFF007F23+ ACACCTAAAACACGACACATGGTTAACAAACATGTCTTGGAAGCCCTGGGAAAGGACGGG
rJMFF020J22+ ACACCTAAAACACGACACATGGTTAACAAACATGTCTTGGAAGCCCTGGGAAAGGACGGG
                      ____________________________________________________________
consensus ACACCTAAAACACGACACATGGTTAACAAACATGTCTTGGAAGCCCTGGGAAAGGACGGG
 
. : . : . : . : . : . :
rJMSF022C08+ ATTCTCATCAACGTTGCCCGGGGCGCTGTCGTGGAGGAGGAGGAGCTGGTGAGGCGTCTG
rJMFF007F23+ ATTNTCATCAACGTTGCCCGGGGCGCTGTCGTGGAGGAGGAGGAGCTGGTGAGGCGTCTG
rJMFF020J22+ ATTCTCATCAACGTTGCCCGGGGCGCTGTCGTGGAGGAGGAGGAGCTGGTGAGGCGTCTG
                      ____________________________________________________________
consensus ATTCTCATCAACGTTGCCCGGGGCGCTGTCGTGGAGGAGGAGGAGCTGGTGAGGCGTCTG
 
. : . : . : . : . : . :
rJMSF022C08+ GTGCGCGGGGAAATAGGCGGTGCCGGTTTGGATGTGTTTGAGAATGAGCCTCAGGTTCCG
rJMFF007F23+ GTGCGCGGGGAAATAGGCGGTGCCGGTTTGGATGTGTTTGAGAATGAGCCTCAGGTTCCG
rJMFF020J22+ GTGCGCGGGGAAATAGGCGGTGCCGGTTTGGATGTGTTTGAGAATGAGCCTCAGGTTCCG
                      ____________________________________________________________
consensus GTGCGCGGGGAAATAGGCGGTGCCGGTTTGGATGTGTTTGAGAATGAGCCTCAGGTTCCG
 
. : . : . : . : . : . :
rJMSF022C08+ CCGGAGTTGTTCGAGTTAGACAACGTTGTTCTCAATCCTCATAGAGGCGCTTTTACTGGT
rJMFF007F23+ CCGGAGTTGTTCGAGTTAGACAACGTTGTTCTCAATCCTCATAGAGGCGCTTTTACTGGT
rJMFF020J22+ CCGGAGTTGTTCGAGTTAGACAACGTTGTTCTCAATCCTCATAGAGGCGCTTTTACTGGT
                      ____________________________________________________________
consensus CCGGAGTTGTTCGAGTTAGACAACGTTGTTCTCAATCCTCATAGAGGCGCTTTTACTGGT
 
. : . : . : . : . : . :
rJMSF022C08+ GAAGCGTTTCGTGAAGCTTTTGAGCTCGTATTGGGTAATTTAGAAGCTTTCTTCTCCGAT
rJMFF007F23+ GAAGCGTTTCGTGAAGCTTTTGAGCTCGTATTGGGTAATTTAGAAGCTTTCTTCTCCGAT
rJMFF020J22+ GAAGCGTTTCGTGAAGCTTTTGAGCTCGTATTGGGTAATTTAGAAGCTTTCTTCTCCGAT
                      ____________________________________________________________
consensus GAAGCGTTTCGTGAAGCTTTTGAGCTCGTATTGGGTAATTTAGAAGCTTTCTTCTCCGAT
 
. : . : . : . : . : . :
rJMSF022C08+ AAACCTTTGGTTTCTCCTGTTGATTTGGATGCATGAACATGCATATATATATATATGCAA
rJMFF007F23+ AAACCTTTGGTTTCTCCTGTTGATTTGGATGCATGAACATGCATATATATATATATGCAA
rJMFF020J22+ AAACCTTTGGTTTCTCCTGTTGATTTGGATGCATGAACATGCATATATATATATATGCAA
                      ____________________________________________________________
consensus AAACCTTTGGTTTCTCCTGTTGATTTGGATGCATGAACATGCATATATATATATATGCAA
 
. : . : . : . : . : . :
rJMSF022C08+ CTGGTCCTGCAATTCATCTGTCTGTTTTGGGGTTTTGACTGAAGTAGGCATAAAAACAAA
rJMFF007F23+ CTGGTCCTGCAATTCATCTGTCTGTTTTGGGGTTTTGACTGAAGTAGGCATAAAAACAAA
rJMFF020J22+ CTGGTCCTGCAATTCATCTGTCTGTTTTGGGGTTTTGACTGAAGTAGGCATAAAAACAAA
                      ____________________________________________________________
consensus CTGGTCCTGCAATTCATCTGTCTGTTTTGGGGTTTTGACTGAAGTAGGCATAAAAACAAA
 
. : . : . : . : . : . :
rJMSF022C08+ AAAGAATCCTGCTAGACTCCACTCCATTTTTCCATTGTATTTTTGTC
rJMFF007F23+ AAAGAATCCTGCTAGACTCCACTCCATTTTT-CATTGTATTTTTGTC
rJMFF020J22+ AAAGAATCCTGCTAGACTCCACTCCATTTTT-CATTGTATTTTTGTCTGACTTGGGAATC
                      ____________________________________________________________
consensus AAAGAATCCTGCTAGACTCCACTCCATTTTT-CATTGTATTTTTGTCTGACTTGGGAATC