Previous Contig 009165:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020I18Sequence472009165 (11)gb:AY086102_15711603e-52Arabidopsis thaliana clone 21357 mRNA, complete sequence.732009165 (11)gb:AB110185_15268983e-67Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein, complete c
JMFF032K05Sequence555009165 (11)gb:AB110185_15268984e-64Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein, complete c734009165 (11)gb:AB110185_15268985e-68Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein, complete c
JMFF033N09Sequence440009165 (11)gb:AY086102_15711603e-52Arabidopsis thaliana clone 21357 mRNA, complete sequence.719009165 (11)gb:AB110185_15268984e-68Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein, complete c
JMFF050C01Sequence655009165 (11)gb:AC073395_15410262e-55Arabidopsis thaliana chromosome 3 BAC F11B9 genomic sequence, complete sequence.419009165 (11)gb:AB110185_15268981e-23Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein, complete c
JMSF014K10Sequence414012753 (25)769009165 (11)gb:AB110185_15268986e-74Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein, complete c
JMSF029K05Sequence656009165 (11)gb:AB110185_15268985e-71Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein, complete c707009165 (11)gb:AB110185_15268981e-68Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein, complete c

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029K05- GGTCAGGTTCTGCTCACTA
                      ____________________________________________________________
consensus GGTCAGGTTCTGCTCACTA
 
. : . : . : . : . : . :
JMFF032K05- ACTGTTTTCTTGAGGGGAAAAT
JMFF033N09- CTCACTGTTTTCTTGAGGGGAAAAT
JMFF050C01- CTCACTGTTTTCTTGAGGGGAAAAT
JMFF020I18- CTCACTGTTTTCTTGAGGGGAAAAT
JMSF029K05- CAGATATAAGCGGCGGCTCTTGAAGTGAGCTCATTCTCACTGTTTTCTTGAGGGGAAAAT
                      ____________________________________________________________
consensus CAGATATAAGCGGCGGCTCTTGAAGTGAGCTCATTCTCACTGTTTTCTTGAGGGGAAAAT
 
. : . : . : . : . : . :
JMFF032K05- TGCAGAAATGGTAGGGCCGACCCGCCCGCAGTTCGTGCTATTCGGATCCTCCATTGTGCA
JMFF033N09- TGCAGAAATGGTAGGGCCGACCCGCCCGCAGTTCGTGCTATTCGGATCCTCCATTGTGCA
JMFF050C01- TGCAGAAATGGTAGGGCCGACCCGCCCGCAGTTCGTGCTATTCGGATCCTCCATTGTGCA
JMFF020I18- TGCAGAAATGGTAGGGCCGACCCGCCCGCAGTTCGTGCTATTCGGATCCTCCATTGTGCA
JMSF029K05- TGCAGAAATGGTAGGGCCGACCCGCCCGCAGTTCGTGCTATTCGGATCCTCCATTGTGCA
rJMSF014K10+ TGCA
                      ____________________________________________________________
consensus TGCAGAAATGGTAGGGCCGACCCGCCCGCAGTTCGTGCTATTCGGATCCTCCATTGTGCA
 
. : . : . : . : . : . :
JMFF032K05- GTTCAGCTTCGGCCAGGAAGGCTGGGGTGCTCTCCTCGCTGATATCTACTCACGCAAGGC
JMFF033N09- GTTCAGCTTCGGCCAGGAAGGCTGGGGTGCTCTCCTCGCTGATATCTACTCACGCAAGGC
JMFF050C01- GTTCAGCTTCGGCCAGGAAGGCTGGGGTGCTCTCCTCGCTGATATCTACTCACGCAAGGC
JMFF020I18- GTTCAGCTTCGGCCAGGAAGGCTGGGGTGCTCTCCTCGCTGATATCTACTCACGCAAGGC
JMSF029K05- GTTCAGCTTCGGCCAGGAAGGCTGGGGTGCTCTCCTCGCTGATATCTACTCACGCAAGGC
rJMSF029K05+ ATCTACTCACGCAAGGC
rJMSF014K10+ GTTCAGCTTCGGCCAGGAAGGCTGGGGTGCTCTCCTCGCTGATATCTACTCACGCGAGGC
rJMFF033N09+ TACTCACGCAAGGC
rJMFF032K05+ CTACTCACGCAAGGC
rJMFF020I18+ ACTCACGCAAGGC
                      ____________________________________________________________
consensus GTTCAGCTTCGGCCAGGAAGGCTGGGGTGCTCTCCTCGCTGATATCTACTCACGCAAGGC
 
. : . : . : . : . : . :
JMFF032K05- AGATGTAGTGCTTCGTGGATATAGTGGTTGGAACTCACGCTGTGCTCTTCAAGTTCTGGA
JMFF033N09- AGATGTAGTGCTTCGTGGATATAGTGGTTGGAACTCACGCTGTGCTCTTCAAGTTCTGGA
JMFF050C01- AGATGTAGTGCTTCGTGGATATAGTGGTTGGAACTCACGCTGTGCTCTTCAAGTTCTGGA
JMFF020I18- AGATGTAGTGCTTCGTGGATATAGTGGTTGGAACTCACGCTGTGCTCTTCAAGTTCTGGA
JMSF029K05- AGATGTAGTGCTTCGTGGATATAGTGGTTGGAACTCACGCTGTGCTCTTCAAGTTCTGGA
rJMSF029K05+ AGATGTAGTGCTTCGTGGATATAGTGGTTGGAACTCACGCTGTGCTCTTCAAGTTCTGGA
rJMSF014K10+ AGATGTAGTGCTTCGTGGATATAGTGGTTGGAACTCACGCTGTGCTCTTCAAGTTCTGGA
rJMFF033N09+ AGATGTAGTGCTTCGTGGATATAGTGGTTGGAACTCACGCTGTGCTCTTCAAGTTCTGGA
rJMFF032K05+ AGATGTAGTGCTTCGTGGATATAGTGGTTGGAACTCACGCTGTGCTCTTCAAGTTCTGGA
rJMFF020I18+ AGATGTAGTGCTTCGTGGATATAGTGGTTGGAACTCACGCTGTGCTCTTCAAGTTCTGGA
                      ____________________________________________________________
consensus AGATGTAGTGCTTCGTGGATATAGTGGTTGGAACTCACGCTGTGCTCTTCAAGTTCTGGA
 
. : . : . : . : . : . :
JMFF032K05- CCAAGTTTTCCCAAAGAATGCAGGCGTACAGCCTTCTCTGGTGATAGTTTACTTTGGAGG
JMFF033N09- CCAAGTTTTCCCAAAGAATGCAGGCGTACAGCCTTCTCTGGTGATAGTTTACTTTGGAGG
JMFF050C01- CCAAG--TTCCCAAAGAATGCAGGCGTACAGCCTTCTCTGGTGATAGTTTACTTTGGAGG
JMFF020I18- CCAAGTTTTCCCAAAGAATGCAGGCGTACAGCCTTCTCTGGTGATAGTTTACTTTGGAGG
JMSF029K05- CCAAGTTTTCCCAAAGAATGCAGGCGTACAGCCTTCTCTGGTGATAGTTTACTTTGGAGG
rJMSF029K05+ CCAAGTTTTCCCAAAGAATGCAGGCGTACAGCCTTCTCTGGTGATAGTTTACTTTGGAGG
rJMSF014K10+ CCAAGTTTTCCCAAAGAATGCAGGCGTACAGCCTTCTCTGGTGATAGTTTACTTTGGAGG
rJMFF033N09+ CCAAGTTTTCCCAAAGAATGCAGGCGTACAGCCTTCTCTGGTGATAGTTTACTTTGGAGG
rJMFF032K05+ CCAAGTTTTCCCAAAGAATGCAGGCGTACAGCCTTCTCTGGTGATAGTTTACTTTGGAGG
rJMFF020I18+ CCAAGTTTTCCCAAAGAATGCAGGCGTACAGCCTTCTCTGGTGATAGTTTACTTTGGAGG
                      ____________________________________________________________
consensus CCAAGTTTTCCCAAAGAATGCAGGCGTACAGCCTTCTCTGGTGATAGTTTACTTTGGAGG
 
. : . : . : . : . : . :
JMFF032K05- CAATGATTCAATGCTACCTGACCCATCTGGACTGAATGCTCATGTTCCGCTTCCTGAATA
JMFF033N09- CAATGATTCAATGCTACCTGACCCATCTGGACTGAATGCTCATGTTCCGCTTCCTGAATA
JMFF050C01- CAATGATTCAATGCTACCTGACCCATCTGGACTGAATGCTCATGTTCCGCTTCCTGAATA
JMFF020I18- CAATGATTCAATGCTACCTGACCCATCTGGACTGAATGCTCATGTTCCGCTTCCTGAATA
JMSF029K05- CAATGATTCAATGCTACCTGACCCATCTGGACTGAATGCTCATGTTCCGCTTCCTGAATA
rJMSF029K05+ CAATGATTCAATGCTACCTGACCCATCTGGACTGAATGCTCATGTTCCGCTTCCTGAATA
rJMSF014K10+ CAATGATTCAATGCTACCTGACCCATCTGGACTGAATGCTCATGTTCCGCTTCCTGAATA
rJMFF033N09+ CAATGATTCAATGCTACCTGACCCATCTGGACTGAATGCTCATGTTCCGCTTCCTGAATA
rJMFF032K05+ CAATGATTCAATGCTACCTGACCCATCTGGACTGAATGCTCATGTTCCGCTTCCTGAATA
rJMFF020I18+ CAATGATTCAATGCTACCTGACCCATCTGGACTGAATGCTCATGTTCCGCTTCCTGAATA
                      ____________________________________________________________
consensus CAATGATTCAATGCTACCTGACCCATCTGGACTGAATGCTCATGTTCCGCTTCCTGAATA
 
. : . : . : . : . : . :
JMFF032K05- TGTTGAAAATATGAGGAAGATTGCTATTCATCTGAAGAGCCTGTCAGATAAAACACGGAT
JMFF033N09- TGTTGAAAATATGAGGAAGATTGCTATTCATCTGAAGAGCCTGTCAGATAAAACACGGAT
JMFF050C01- TGTTGAAAATATGAGGAAGATTGCTATTCATCTGAAGAGCCTGTCAGATAAAACACGGAT
JMFF020I18- TGTTGAAAATATGAGGAAGATTGCTATTCATCTGAAGAGCCTGTCAGATAAAACACGGAT
JMSF029K05- TGTTGAAAATATGAGGAAGATTGCTATTCATCTGAAGAGCCTGTCAGATAAAACACGGAT
rJMSF029K05+ TGTTGAAAATATGAGGAAGATTGCTATTCATCTGAAGAGCCTGTCAGATAAAACACGGAT
rJMSF014K10+ TGTTGAAAATATGAGGAAGATTGCTATTCATCTGAAGAGCCTGTCAGATAAAACACGGAT
rJMFF033N09+ TGTTGAAAATATGAGGAAGATTGCTATTCATCTGAAGAGCCTGTCAGATAAAACACGGAT
rJMFF032K05+ TGTTGAAAATATGAGGAAGATTGCTATTCATCTGAAGAGCCTGTCAGATAAAACACGGAT
rJMFF020I18+ TGTTGAAAATATGAGGAAGATTGCTATTCATCTGAAGAGCCTGTCAGATAAAACACGGAT
                      ____________________________________________________________
consensus TGTTGAAAATATGAGGAAGATTGCTATTCATCTGAAGAGCCTGTCAGATAAAACACGGAT
 
. : . : . : . : . : . :
JMFF032K05- AATCTTTCTCAGTTGCCCTCCCATCAATGAAGCACGGGCTCTTGAAGTTTTCGGTACCTT
JMFF033N09- AATCTTTCTCAGTTGCCCTCCCATCAATGAAGCACGGGCTCTTGAAGTTTTCGGT
JMFF050C01- AATCTTTCTCAGTTGCCCTCCCATCAATGAAGCACGGGCTCTTGAAGTTTTCGG
JMFF020I18- AATCTTTCTCAGTTGCCCTCCCATCAATGAAGCACGGGCTCTTGAAGTTTTCGGTACCTT
JMSF029K05- AATCTTTCTCAGTTGCCCTCCCATCAATGAAGCACGGGCTCTTGAAGTTTTCGGTACCTT
rJMSF029K05+ AATCTTTCTCAGTTGCCCTCCCATCAATGAAGCACGGGCTCTTGAAGTTTTCGGTACCTT
rJMSF014K10+ AATCTTTCTCAGTTGCCCTCCCATCAATGAAGCACGGGCTCTTGAAGTTTTCGGTACCTT
rJMFF033N09+ AATCTTTCTCAGTTGCCCTCCCATCAATGAAGCACGGGCTCTTGAAGTTTTCGGTACCTT
rJMFF032K05+ AATCTTTCTCAGTTGCCCTCCCATCAATGAAGCACGGGCTCTTGAAGTTTTCGGTACCTT
rJMFF050C01+ GTACCTC
rJMFF020I18+ AATCTTTCTCAGTTGCCCTCCCATCAATGAAGCACGGGCTCTTGAAGTTTTCGGTACCTT
                      ____________________________________________________________
consensus AATCTTTCTCAGTTGCCCTCCCATCAATGAAGCACGGGCTCTTGAAGTTTTCGGTACCTT
 
. : . : . : . : . : . :
JMFF032K05- AGGCAGATCAAATGAGTTGGGCAGAAAATACTCAGAAGCATGCATAGAATTGTGCAAACA
JMFF020I18- AGGCAGATCAAATGAGTTGGGCAG
JMSF029K05- AGGCAGATCAAATGAGTTGGGCAGAAAATACTCAGAAGCATGCATAGAATTGTGCAAACA
rJMSF029K05+ AGGCAGATCAAATGAGTTGGGCAGAAAATACTCAGAAGCATGCATAGAATTGTGCAAACA
rJMSF014K10+ AGGCAGATCAAATGAGTTGGGCAGAAAATACTCAGAAGCATGCATAGAATTGTGCAAACA
rJMFF033N09+ AGGCAGATCAAATGAGTTGGGCAGAAAATACTCAGAAGCATGCATAGAATTGTGCAAACA
rJMFF032K05+ AGGCAGATCAAATGAGTTGGGCAGAAAATACTCAGAAGCATGCATAGAATTGTGCAAACA
rJMFF050C01+ AGGCAGATCAAATGAGTTGGGCAGAAAATACTCAGCAGCATCCATCGAAGTGTGCAACCA
rJMFF020I18+ AGGCAGATCAAATGAGTTGGGCAGAAAATACTCAGAAGCATGCATAGAATTGTGCAAACA
                      ____________________________________________________________
consensus AGGCAGATCAAATGAGTTGGGCAGAAAATACTCAGAAGCATGCATAGAATTGTGCAAACA
 
. : . : . : . : . : . :
JMFF032K05- GTTGGATGTGAAAGTAATAGATCTATGGACAGCACTTCAGCAGCGGGATGATT
JMSF029K05- GTTGGATGTGAAAGTAATAGATCTATGGACAGCACTTCAGCAGCGGGATGATTGGTTGAT
rJMSF029K05+ GTTGGATGTGAAAGTAATAGATCTATGGACAGCACTTCAGCAGCGGGATGATTGGTTGAT
rJMSF014K10+ GTTGGATGTGAAAGTAATAGATCTATGGACAGCACTTCAGCAGCGGGATGATTGGTTGAT
rJMFF033N09+ GTTGGATGTGAAAGTAATAGATCTATGGACAGCACTTCAGCAGCGGGATGATTGGTTGAT
rJMFF032K05+ GTTGGATGTGAAAGTAATAGATCTATGGACAGCACTTCAGCAGCGGGATGATTGGTTGAT
rJMFF050C01+ GTTGGATGTGAAAGTAATAGATCTATGGTCAGCACTTCAGCAGCGGGAGGATTGGTGGAT
rJMFF020I18+ GTTGGATGTGAAAGTAATAGATCTATGGACAGCACTTCAGCAGCGGGATGATTGGTTGAT
                      ____________________________________________________________
consensus GTTGGATGTGAAAGTAATAGATCTATGGACAGCACTTCAGCAGCGGGATGATTGGTTGAT
 
. : . : . : . : . : . :
JMSF029K05- TACTTGCTTTACGGATGGAATCCATTTAACGTCTGA
rJMSF029K05+ TACTTGCTTTACGGATGGAATCCATTTAACGTCTGAGGGAAGCAAGATTGTGGTGAAAGA
rJMSF014K10+ TACTTGCTTTACGGATGGAATCCATTTAACGTCTGAGGGAAGCAAGATTGTGGTGAAAGA
rJMFF033N09+ TACTTGCTTTACGGATGGAATCCATTTAACGTCTGAGGGAAGCAAGATTGTGGTGAAAGA
rJMFF032K05+ TACTTGCTTTACGGATGGAATCCATTTAACGTCTGAGGGAAGCAAGATTGTGGTGAAAGA
rJMFF050C01+ TACTTCCTTTACGGATGGAATCCATCTAACGTGGGAGGGAAGCAACATTGTGGTGAAAGA
rJMFF020I18+ TACTTGCTTTACGGATGGAATCCATTTAACGTCTGAGGGAAGCAAGATTGTGGTGAAAGA
                      ____________________________________________________________
consensus TACTTGCTTTACGGATGGAATCCATTTAACGTCTGAGGGAAGCAAGATTGTGGTGAAAGA
 
. : . : . : . : . : . :
rJMSF029K05+ AATTTTGAAGGTGCTAAAAGAGGCTGATTGGGAGCCGAGTCTACATTGGCAGTCGTTAGC
rJMSF014K10+ AATTTTGAAGGTGCTAAAAGAGGCTGATTGGGAGCCGAGTCTACATTGGCAGTCGTTAGC
rJMFF033N09+ AATTTTGAAGGTGCTAAAAGAGGCTGATTGGGAGCCGAGTCTACATTGGCAGTCGTTAGC
rJMFF032K05+ AATTTTGAAGGTGCTAAAAGAGGCTGATTGGGAGCCGAGTCTACATTGGCAGTCGTTAGC
rJMFF050C01+ AATTTTGAAGGTGCTAAAAGAGGCCGATTGGGAGCCGAGTGTTCATCGGCAGCCGTTAGC
rJMFF020I18+ AATTTTGAAGGTGCTAAAAGAGGCTGATTGGGAGCCGAGTCTACATTGGCAGTCGTTAGC
                      ____________________________________________________________
consensus AATTTTGAAGGTGCTAAAAGAGGCTGATTGGGAGCCGAGTCTACATTGGCAGTCGTTAGC
 
. : . : . : . : . : . :
rJMSF029K05+ CAACGAGTTTTCTGAAACCTCACCCATCATATTTATAGGTCCCAATAAGACCCCTATTAA
rJMSF014K10+ CAACGAGTCTTCTGAAACCTCACCCATCATATTTATAGGTCCCAATAAGACCCCTATTAA
rJMFF033N09+ CAACGAGTTTTCTGAAACCTCACCCATCATATTTATAGGTCCCAATAAGACCCCTATTAA
rJMFF032K05+ CAACGAGTTTTCTGAAACCTCACCCATCATATTTATAGGTCCCAATAAGACCCCTATTAA
rJMFF050C01+ CAACGAGTTTTTTGAAACCTCCCCCATCATATTTATAGGTGCCAATAAGACCCCTATTAA
rJMFF020I18+ CAACGAGTTTTCTGAAACCTCACCCATCATATTTATAGGTCCCAATAAGACCCCTATTAA
                      ____________________________________________________________
consensus CAACGAGTTTTCTGAAACCTCACCCATCATATTTATAGGTCCCAATAAGACCCCTATTAA
 
. : . : . : . : . : . :
rJMSF029K05+ CACTTCTCAACTGACATTTTATTGGCAACCACAGTGGAATTAGATCTTCTCTTTTCATGA
rJMSF014K10+ CACTTCTCAACTGACATTTTATTGGCAACCACAGTGGAATTAGATCTTCTCTTTTCATGA
rJMFF033N09+ CACTTCTCAACTGACATTTTATTGGCAACCACAGTGGAATTAGATCTTCTCTTTTCATGA
rJMFF032K05+ CACTTCTCAACTGACATTTTATTGGCAACCACAGTGGAATTAGATCTTCTCTTTTCATGA
rJMFF050C01+ CACTTCTCATCTGACATCTTATTGGCAACCACAGCGGAATTAGATCTTCTTTTTTCATGA
rJMFF020I18+ CACTTCTCAACTGACATTTTATTGGCAACCACAGTGGAATTAGATCTTCTCTTTTCATGA
                      ____________________________________________________________
consensus CACTTCTCAACTGACATTTTATTGGCAACCACAGTGGAATTAGATCTTCTCTTTTCATGA
 
. : . : . : . : . : . :
rJMSF029K05+ TGCTTGCTTTCTGCAACTCTATGAT-AATAT
rJMSF014K10+ TGCTTGCTTTCTGCAACTCTATGATAAATATGTAAAC
rJMFF033N09+ TGCTTGCTTTCTGCAACTCTATGAT-AATATGTAAACATTTAACA
rJMFF032K05+ TGCTTGCTTTCTGCAACTCTATGAT-AATATGTAAACATTTAACATTGTATTTTGTGACG
rJMFF050C01+ GGCTGGCTTTCTGCAGCTCTATGAT-AATAAGTAAACATCTAACA
rJMFF020I18+ TGCTTGCTTTCTGCAACTCTATGAT-AATATGTAAACATTTAACATTGTATTTTGTGACG
                      ____________________________________________________________
consensus TGCTTGCTTTCTGCAACTCTATGAT-AATATGTAAACATTTAACATTGTATTTTGTGACG