Previous Contig 009160:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020F21Sequence570007899 (3)gb:AB006708_15100502e-35Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:AY045798_1561705009160 (3)gb:AB006708_15100503e-65Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:AY045798_1561
JMFF032M10Sequence550007899 (3)gb:AB006708_15100508e-33Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:AY045798_1561667009160 (3)gb:AB006708_15100508e-60Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:AY045798_1561
JMSF049C23Sequence551007899 (3)gb:AB006708_15100508e-33Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:AY045798_1561695009160 (3)gb:AB006708_15100508e-77Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:AY045798_1561

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF049C23+ TCTGCAGAACCAACTCTCATT
                      ____________________________________________________________
consensus TCTGCAGAACCAACTCTCATT
 
. : . : . : . : . : . :
rJMSF049C23+ GTGGGGGCTGGTGGGGCATTATTCATTGCATATCTCCTCATTCCACCCATCTTTTCAGTC
                      ____________________________________________________________
consensus GTGGGGGCTGGTGGGGCATTATTCATTGCATATCTCCTCATTCCACCCATCTTTTCAGTC
 
. : . : . : . : . : . :
rJMSF049C23+ ATCTCTTCGAGCCTTCGTGGTTACAAGGGTGAGCTCACTCCTGCTCAAACTCTGGATCTG
rJMFF032M10+ TGCTCAAACTCTGGATCTG
rJMFF020F21+ CGTGGTTACAAGGGTGAGCTCACTCCTGCTCAAACTCTGGATCTG
                      ____________________________________________________________
consensus ATCTCTTCGAGCCTTCGTGGTTACAAGGGTGAGCTCACTCCTGCTCAAACTCTGGATCTG
 
. : . : . : . : . : . :
rJMSF049C23+ ATGTGTACCAAGAATTACAATTTGATCGATATTAGGTCGGAGACAGACAAGGGCAAGGCT
rJMFF032M10+ ATGTGTACCAAGAATTACAATTTGATCGATATTAGGTCGGAGACAGACAAGGGCAAGGCT
rJMFF020F21+ ATGTGTACCAAGAATTACAATTTGATCGATATTAGGTCGGAGACAGACAAGGGCAAGGCT
                      ____________________________________________________________
consensus ATGTGTACCAAGAATTACAATTTGATCGATATTAGGTCGGAGACAGACAAGGGCAAGGCT
 
. : . : . : . : . : . :
rJMSF049C23+ GGAGTTCCTCGCCTTCCATCTAATGCTAAAAATAAGATGATTTCTATCCCTTTGGAAGAT
rJMFF032M10+ GGAGTTCCTCGCCTTCCATCTAATGCTAAAAATAAGATGATTTCTATCCCTTTGGAAGAT
rJMFF020F21+ GGAGTTCCTCGCCTTCCATCTAATGCTAAAAATAAGATGATTTCTATCCCTTTGGAAGAT
                      ____________________________________________________________
consensus GGAGTTCCTCGCCTTCCATCTAATGCTAAAAATAAGATGATTTCTATCCCTTTGGAAGAT
 
. : . : . : . : . : . :
rJMSF049C23+ TTACCAAATAAGGTAAGAAGTCTGGTGAAAAATCCCAAGAAACTACAAGCTGAATTGGTA
rJMFF032M10+ TTACCAAATAAGGTAAGAAGTCTGGTGAAAAATCCCAAGAAACTACAAGCTGAATTGGTA
rJMFF020F21+ TTACCAAATAAGGTAAGAAGTCTGGTGAAAAATCCCAAGAAACTACAAGCTGAATTGGTA
                      ____________________________________________________________
consensus TTACCAAATAAGGTAAGAAGTCTGGTGAAAAATCCCAAGAAACTACAAGCTGAATTGGTA
 
. : . : . : . : . : . :
rJMSF049C23+ GCTGTGAAAATATCATATCTGAAGAAAATCAACAAGGGATCCGATATTGTTATCCTCGAC
rJMFF032M10+ GCTGTGAAAATATCATATCTGAAGAAAATCAACAAGGGATCCGATATTGTTATCCTCGAC
rJMFF020F21+ GCTGTGAAAATATCATATCTGAAGAAAATCAACAAGGGATCCGATATTGTTATCCTCGAC
                      ____________________________________________________________
consensus GCTGTGAAAATATCATATCTGAAGAAAATCAACAAGGGATCCGATATTGTTATCCTCGAC
 
. : . : . : . : . : . :
rJMSF049C23+ TCGTACGCGGATTCATCTAAGACAGTGGCGAGAACCCTGACAAGCCTGGGATTCAAGAAC
rJMFF032M10+ TCGTACGCGGATTCATCTAAGACAGTGGCGAGAACCCTGACAAGCCTGGGATTCAAGAAC
rJMFF020F21+ TCGTACGCGGATTCATCTAAGACAGTGGCGAGAACCCTGACAAGCCTGGGATTCAAGAAC
                      ____________________________________________________________
consensus TCGTACGCGGATTCATCTAAGACAGTGGCGAGAACCCTGACAAGCCTGGGATTCAAGAAC
 
. : . : . : . : . : . :
rJMSF049C23+ TGCTGGATCGTGACCGATGGCTTCTCTGGAAGCAAAGGGTGGCTGCAGAGCCGGCTAGGC
rJMFF032M10+ TGCTGGATCGTGACCGATGGCTTCTCTGGAAGCAAAGGGTGGCTGCAGAGCCGGCTAGGC
rJMFF020F21+ TGCTGGATCGTGACCGATGGCTTCTCTGGAAGCAAAGGGTGGCTGCAGAGCCGGCTAGGC
                      ____________________________________________________________
consensus TGCTGGATCGTGACCGATGGCTTCTCTGGAAGCAAAGGGTGGCTGCAGAGCCGGCTAGGC
 
. : . : . : . : . : . :
rJMSF049C23+ ACAGATTCATACTTCCTCTCCGCGGCTGAAGTTTTATCTCCATCGCGCATTATTCCTGCA
rJMFF032M10+ ACAGATTCATACTTCCTCTCCGCGGCTGAAGTTTTATCTCCATCGCGCATTATTCCTGCA
rJMFF020F21+ ACAGATTCATACTTCCTCTCCGCGGCTGAAGTTTTATCTCCATCGCGCATTATTCCTGCA
                      ____________________________________________________________
consensus ACAGATTCATACTTCCTCTCCGCGGCTGAAGTTTTATCTCCATCGCGCATTATTCCTGCA
 
. : . : . : . : . : . :
rJMSF049C23+ GCCACCAGGCGTTTTGGCACGACAGGCACTGCGAAATTGCTGCCAGGGGGTTCTGATTAA
rJMFF032M10+ GCCACCAGGCGTTTTGGCACGACAGGCACTGCGAAATTGCTGCCAGGGGGTTCTGATTAA
rJMFF020F21+ GCCACCAGGCGTTTTGGCACGACAGGCACTGCGAAATTGCTGCCAGGGGGTTCTGATTAA
                      ____________________________________________________________
consensus GCCACCAGGCGTTTTGGCACGACAGGCACTGCGAAATTGCTGCCAGGGGGTTCTGATTAA
 
. : . : . : . : . : . :
rJMSF049C23+ ATGTTCCACCTTGTACAACAAACACTCATATAACTGTAATTCTATATAGTTAGAGATCCT
rJMFF032M10+ ATGTTCCACCTTGTACAACAAACACTCATATAACTGTAATTCTATATAGTTAGAGATCCT
rJMFF020F21+ ATGTTCCACCTTGTACAACAAACACTCATATAACTGTAATTCTATATAGTTAGAGATCCT
                      ____________________________________________________________
consensus ATGTTCCACCTTGTACAACAAACACTCATATAACTGTAATTCTATATAGTTAGAGATCCT
 
. : . : . : . : . : . :
rJMSF049C23+ ATGCATCTTTCTGC
rJMFF032M10+ ATGCATCTTTCTGCTGCAATTCTTTCATTAGTTCTAATGAATCAAATTTTTTTGCATATT
rJMFF020F21+ ATGCATCTTTCTGCTGCAATTCTTTCATTAGTTCTAATGAATCAAATTTTTTTGCATATT
                      ____________________________________________________________
consensus ATGCATCTTTCTGCTGCAATTCTTTCATTAGTTCTAATGAATCAAATTTTTTTGCATATT
 
. : . : . : . : . : . :
rJMFF032M10+ ACAACTGTGAATACTGCTAAGATGTTTACTAGCAATAACAATATCAAT
rJMFF020F21+ ACAACTGTGAATACTGCTAAGATGTTTACTAGCAATAACAATATCAATGTTCATAAATTA
                      ____________________________________________________________
consensus ACAACTGTGAATACTGCTAAGATGTTTACTAGCAATAACAATATCAATGTTCATAAATTA