Previous Contig 009153:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020E06Sequence578007414 (4)gb:AP007226_18633094e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN651009153 (4)pir|C85435|C854352e-48hypothetical protein AT4g36860 [imported] - Arabidopsis thaliana>gb:ATAP22_15440
JMSF002H24Sequence267009153 (4)gb:AY062599_15652554e-26Arabidopsis thaliana Unknown protein mRNA, complete cds.>gb:AY114659_1578701 Ara669022028gb:LJA575254_16849931e-11Lotus japonicus nfr5 gene for Nod-factor receptor 5.>gb:LJA575255_1684994 Lotus
JMSF041F18Sequence791007414 (4)gb:AP007226_18633093e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN750009153 (4)gb:AP007226_18633091e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF042D14Sequence744007414 (4)gb:AP007226_18633096e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN768009153 (4)gb:AC091246_17347249e-62Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0002I03 map E141

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041F18+ AATGAAGCCATGGAAGGAGAAAAGAAT-GG
rJMSF042D14+ AGCCATGGAAGGAGAAAAGAATNGG
                      ____________________________________________________________
consensus AATGAAGCCATGGAAGGAGAAAAGAATNGG
 
. : . : . : . : . : . :
rJMSF041F18+ GCATCATCACATGCCTG-AAACAAGAGGACTTTGCTTGTCTGAAGAACAGACAGTCAGCA
rJMSF042D14+ GCATCATCACATGCCTGAAAACAAGAGGACTTTGCTTGTCTGAAGAACAGACAGTCAGCA
                      ____________________________________________________________
consensus GCATCATCACATGCCTGAAAACAAGAGGACTTTGCTTGTCTGAAGAACAGACAGTCAGCA
 
. : . : . : . : . : . :
rJMSF041F18+ CTATTTTGAGGCGGCCAAGAATT-GGGGGGAATAGAATCACAGATATGTTCACAGAGCCT
rJMSF042D14+ CTATTTTGAGGCGGCCAAGAATTGGGGGGGAATAGAATCACAGATATGTTCACAGAGCCT
                      ____________________________________________________________
consensus CTATTTTGAGGCGGCCAAGAATTGGGGGGGAATAGAATCACAGATATGTTCACAGAGCCT
 
. : . : . : . : . : . :
rJMSF041F18+ TACAGGCTAATTCGTAGGTGCGAAGTGACTGCAATACTCATCTTGTATGGCCTTCCGAGG
rJMSF042D14+ TACAGGCTAATTCGTAGGTGCGAAGTGACTGCAATACTCATCTTGTATGGCCTTCCGAGG
                      ____________________________________________________________
consensus TACAGGCTAATTCGTAGGTGCGAAGTGACTGCAATACTCATCTTGTATGGCCTTCCGAGG
 
. : . : . : . : . : . :
rJMSF041F18+ TTGCTGACCGGCTCAATCCTGGCTCATGAGATGATGCATGCATACCTGCGGCTTAAAGGT
rJMSF042D14+ TTGCTGACCGGCTCAATCCTGGCTCATGAGATGATGCATGCATACCTGCGGCTTAAAGGT
JMSF002H24- CATGAGATGATGCATGCATGGTTGCGGCTTCAAGGT
rJMFF020E06+ CATGAGATGATGCATGCATACCTGCGGCTTAAAGGT
                      ____________________________________________________________
consensus TTGCTGACCGGCTCAATCCTGGCTCATGAGATGATGCATGCATACCTGCGGCTTAAAGGT
 
. : . : . : . : . : . :
rJMSF041F18+ TATCCCAATCTAAGCCCAGAAATAGAAGAAGGAATCTGCCAAGTCTTAGCTCACATGTGG
rJMSF042D14+ TATCCCAATCTAAGCCCAGAAATAGAAGAAGGAATCTGCCAAGTCTTAGCTCACATGTGG
JMSF002H24- TATCCCAATCTTAGCCCAGAAGTCGAAGAAGGTATCTGCCAAGTCCTAGCTCACATGTGG
rJMFF020E06+ TATCCCAATCTAAGCCCAGAAATAGAAGAAGGAATCTGCCAAGTCTTAGCTCACATGTGG
                      ____________________________________________________________
consensus TATCCCAATCTAAGCCCAGAAATAGAAGAAGGAATCTGCCAAGTCTTAGCTCACATGTGG
 
. : . : . : . : . : . :
rJMSF041F18+ TTAGATTCAGAAATCATAGCCGGTTCTGGTAGCAGCAGCACTGCATCTACTTCTTCGTCT
rJMSF042D14+ TTAGATTCAGAAATCATAGCCGGTTCTGGTAGCAGCAGCACTGCATCTACTTCTTCGTCT
JMSF002H24- TTGGATTCTGAAATTTTAGCCGGTTCTGGTAG
rJMFF020E06+ TTAGATTCAGAAATCATAGCCGGTTCTGGTAGCAGCAGCACTGCATCTACTTCTTCGTCT
                      ____________________________________________________________
consensus TTAGATTCAGAAATCATAGCCGGTTCTGGTAGCAGCAGCACTGCATCTACTTCTTCGTCT
 
. : . : . : . : . : . :
rJMSF041F18+ TCTTCGTCTGCAACCTCACCATCATCATCGTCATCATCGTCCACTACCTCTTCAAAGAAG
rJMSF042D14+ TCTTCGTCTGCAACCTCACCATCATCATCGTCATCATCGTCCACTACCTCTTCAAAGAAG
rJMFF020E06+ TCTTCGTCTGCAACCTCACCATCATCATCGTCATCATCGTCCACTACCTCTTCAAAGAAG
                      ____________________________________________________________
consensus TCTTCGTCTGCAACCTCACCATCATCATCGTCATCATCGTCCACTACCTCTTCAAAGAAG
 
. : . : . : . : . : . :
rJMSF041F18+ GGTACCCGGTCGCAGTTCGAGAAGAAACTGGGCGAGTTTTTCAAGCACCAGATAGAATCA
rJMSF042D14+ GGTACCCGGTCGCAGTTCGAGAAGAAACTGGGCGAGTTTTTCAAGCACCAGATAGAATCA
rJMFF020E06+ GGTACCCGGTCGCAGTTCGAGAAGAAACTGGGCGAGTTTTTCAAGCACCAGATAGAATCA
                      ____________________________________________________________
consensus GGTACCCGGTCGCAGTTCGAGAAGAAACTGGGCGAGTTTTTCAAGCACCAGATAGAATCA
 
. : . : . : . : . : . :
rJMSF041F18+ GACACTTCTGTAGCTTATGGCGATGGGTTCAGAGAAGGCAACAAGGCAGTGCTCAAGTAC
rJMSF042D14+ GACACTTCTGTAGCTTATGGCGATGGGTTCAGAGAAGGCAACAAGGCAGTGCTCAAGTAC
rJMFF020E06+ GACACTTCTGTAGCTTATGGCGATGGGTTCAGAGAAGGCAACAAGGCAGTGCTCAAGTAC
                      ____________________________________________________________
consensus GACACTTCTGTAGCTTATGGCGATGGGTTCAGAGAAGGCAACAAGGCAGTGCTCAAGTAC
 
. : . : . : . : . : . :
rJMSF041F18+ GGCCTCAGGAGTACACTTGACCATATTCGGCTAACTGGAAGCTTTCCTTGCTGATCTGAT
rJMSF042D14+ GGCCTCAGGAGTACACTTGACCATATTCGGCTAACTGGAAGCTTTCCTTGCTGATCTGAT
rJMFF020E06+ GGCCTCAGGAGTACACTTGACCATATTCGGCTAACTGGAAGCTTTCCTTGCTGATCTGAT
                      ____________________________________________________________
consensus GGCCTCAGGAGTACACTTGACCATATTCGGCTAACTGGAAGCTTTCCTTGCTGATCTGAT
 
. : . : . : . : . : . :
rJMSF041F18+ GAGGTTTTCCACTTCCAGTCATACTTTATATATATACTTTGATACCAGTTTTATAGGACA
rJMSF042D14+ GAGGTTTTCCACTTCCAGTCATACTTTATATATATACTTTGATACCAGTTTTATAGGACA
rJMFF020E06+ GAGGTTTTCCACTTCCAGTCATACTTTATATATATACTTTGATACCAGTTTTATAGGACA
                      ____________________________________________________________
consensus GAGGTTTTCCACTTCCAGTCATACTTTATATATATACTTTGATACCAGTTTTATAGGACA
 
. : . : . : . : . : . :
rJMSF041F18+ AACCCCCCCATGCATATACAAATCATAAAGATGTAATGAATCCCAATAAATACGTGTATG
rJMSF042D14+ AACCCCCCCATGCATATACAAATCATAAAGATGTAATGAAT-CCAATAAATACGTGTATG
rJMFF020E06+ AACCCCCCCATGCATATACAAATCATAAAGATGTAATGAAT-CCAATAAATACGTGTATG
                      ____________________________________________________________
consensus AACCCCCCCATGCATATACAAATCATAAAGATGTAATGAAT-CCAATAAATACGTGTATG
 
. : . : . : . : . : . :
rJMSF041F18+ TAT
rJMSF042D14+ TATTATAGAGTGCAACATATATAT
rJMFF020E06+ TATTATAGAGTGCAACATATATATTGTGATTATGATATTTATATACATAACAACATCAAT
                      ____________________________________________________________
consensus TATTATAGAGTGCAACATATATATTGTGATTATGATATTTATATACATAACAACATCAAT