Previous Contig 009150:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020C12Sequence520009150 (7)gb:AC108499_17384683e-30Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1187_E11, complete s747009150 (7)gb:AC006081_15334284e-40Arabidopsis thaliana chromosome 2 clone T2G17 map mi148, complete sequence.>gb:A
JMFF033F04Sequence525009150 (7)gb:AC108499_17384687e-48Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1187_E11, complete s680009150 (7)gb:AC006081_15334283e-40Arabidopsis thaliana chromosome 2 clone T2G17 map mi148, complete sequence.>gb:A
JMSF016A01Sequence506009150 (7)gb:AC108499_17384683e-42Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1187_E11, complete s770009150 (7)pir|C84585|C845851e-92hypothetical protein At2g20120 [imported] - Arabidopsis thaliana>gb:AC006081_153
JMSF032O20Sequence694006944 (3)675009150 (7)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF016A01- GGGGGGA
JMFF020C12- GATAAAAGGGGAGA
JMFF033F04- GGGGAGA
                      ____________________________________________________________
consensus GATAAAAGGGGAGA
 
. : . : . : . : . : . :
JMSF016A01- GATAGAGAGAGAGAGAGACTGTTGAAATCTGTANACTACTGAGCAAAGAANAGTCTGAAA
JMFF020C12- GATAGAGAGAGAGAGAGACTGTTGAAATCTGTAGACTACTGAGCAAAGAAGAGTCTGAAA
JMFF033F04- GATAGAGAGAGAGAGAGACTGTTGAAATCTGTAGACTACTGAGCAAAGAAGAGTCTGAAA
                      ____________________________________________________________
consensus GATAGAGAGAGAGAGAGACTGTTGAAATCTGTAGACTACTGAGCAAAGAAGAGTCTGAAA
 
. : . : . : . : . : . :
JMSF016A01- TTGGGTTTGCGGAGGAAAGTAATGGGAGATGACAAATCGGGGATGGTGGGTACTATTGGG
JMFF020C12- TTGGGTTTGCGGAGGAAAGTAATGGGAGATGACAAATCGGGGATGGTGGGTACTATTGGG
JMFF033F04- TTGGGTTTGCGGAGGAAAGTAATGGGAGATGACAAATCGGGGATGGTGGGTACTATTGGG
                      ____________________________________________________________
consensus TTGGGTTTGCGGAGGAAAGTAATGGGAGATGACAAATCGGGGATGGTGGGTACTATTGGG
 
. : . : . : . : . : . :
JMSF016A01- AACTCCAGTANANAAAGANATCGGGAGCTTCTCATACCCGTGGCTGTCTCCGCCGGCGGC
JMFF020C12- AACTCCAGTAGAGAAAGAGATCGGGAGCTTCTCATACCCGTGGCTGTCTCCGCCGGCGGC
JMFF033F04- AACTCCAGTAGAGAAAGAGATCGGGAGCTTCTCATACCCGTGGCTGTCTCCGCCGGCGGC
                      ____________________________________________________________
consensus AACTCCAGTAGAGAAAGAGATCGGGAGCTTCTCATACCCGTGGCTGTCTCCGCCGGCGGC
 
. : . : . : . : . : . :
JMSF016A01- GTTGACNACCATGACTCCAAGCCGTCGTCCTCCGCCGCGTCTGCTCACCACCTTCATTCC
JMFF020C12- GTTGACGACCATGACTCCAAGCCGTCGTCCTCCGCCGCGTCTGCTCACCACCTTCGTTCC
JMFF033F04- GTTGACGACCATGACTCCAAGCCGTCGTCCTCCGCCGCGTCTGCTCACCACCTTCATTCC
                      ____________________________________________________________
consensus GTTGACGACCATGACTCCAAGCCGTCGTCCTCCGCCGCGTCTGCTCACCACCTTCATTCC
 
. : . : . : . : . : . :
JMSF016A01- GGCCGCGAGACTTTCTACAAAGTTGTTAGGAGTTGGGCTTCAAAGAAATTCATGACTGGA
JMFF020C12- GGCCGCGAGACTTTCTACAAAGTTGTTAGGAGTTGGGCTTCAAAGAAATTCATGACTGGA
JMFF033F04- GGCCGCGAGACTTTCTACAAAGTTGTTAGGAGTTGGGCTTCAAAGAAATTCATGACTGGA
                      ____________________________________________________________
consensus GGCCGCGAGACTTTCTACAAAGTTGTTAGGAGTTGGGCTTCAAAGAAATTCATGACTGGA
 
. : . : . : . : . : . :
JMSF016A01- TGTGTCATTCTATTTCCAATAGCAGTGACATTTTATATAACATGGNGGTTTATTCACTTT
JMFF020C12- TGTGTCATTCTATTTCCAATAGCAGTGACATTTTATATAACATGGTGGTTTATTCACTTT
JMFF033F04- TGTGTCATTCTATTTCCAATAGCAGTGACATTTTATATAACATGGTGGTTTATTCACTTT
rJMSF016A01+ ATAGCAGTGACATTTTATATAACATGGTGGTTTATTCACTTT
                      ____________________________________________________________
consensus TGTGTCATTCTATTTCCAATAGCAGTGACATTTTATATAACATGGTGGTTTATTCACTTT
 
. : . : . : . : . : . :
JMSF016A01- GTGGATAGCTTTTTCTCCCCCATCTATCTGCAGCTTGGTATCAATATATTTGGTCTCGGA
JMFF020C12- GTGGATAGCTTTTTCTCCCCCATCTATCTGCAGCTTGGTATCA--ATATTTGGTCTCGGA
JMFF033F04- GTGGATAGCTTTTTCTCCCCCATCTATCTGCAGCTTGGTATCAATATATTTGGTCTCGGA
rJMSF016A01+ GTGGATAGCTTTTTCTCCCCCATCTATCTGCAGCTTGGTATCAATATATTTGGTCTCGGA
                      ____________________________________________________________
consensus GTGGATAGCTTTTTCTCCCCCATCTATCTGCAGCTTGGTATCAATATATTTGGTCTCGGA
 
. : . : . : . : . : . :
JMSF016A01- TTTGTGACCTCAATCACTTTCATTTTCTTGGTTGGAGTATTCATGTCATCATGGTTGGGG
JMFF020C12- TTTGTGACCTCAATCACTTTCATTTTCTTGGTTGGAGTATTCATGTCATCATGGTTGGGG
JMFF033F04- TTTGTGACCTCAATCACTTTCATTTTCTTGGTTGGAGTATTCATGTCATCATGGTTGGGG
rJMSF016A01+ TTTGTGACCTCAATCACTTTCATTTTCTTGGTTGGAGTATTCATGTCATCATGGTTGGGG
                      ____________________________________________________________
consensus TTTGTGACCTCAATCACTTTCATTTTCTTGGTTGGAGTATTCATGTCATCATGGTTGGGG
 
. : . : . : . : . : . :
JMSF016A01- GCATCTGTTTTAG
JMFF020C12- GCATCTGTTTTAGGTCTTGGGGAATGGT
JMFF033F04- GCATCTGTTTTAGGTCTTGGGGAATGGTTCATC
rJMSF016A01+ GCATCTGTTTTAGGTCTTGGGGAATGGTTCATCAAAAGAATGCCTTTTGTTCGTCATATC
                      ____________________________________________________________
consensus GCATCTGTTTTAGGTCTTGGGGAATGGTTCATCAAAAGAATGCCTTTTGTTCGTCATATC
 
. : . : . : . : . : . :
rJMSF016A01+ TATAATGCCTCTAAGCAAATTAGTTCTGCCATATCTCCAGATCAGAACACTCAGGCTTTC
                      ____________________________________________________________
consensus TATAATGCCTCTAAGCAAATTAGTTCTGCCATATCTCCAGATCAGAACACTCAGGCTTTC
 
. : . : . : . : . : . :
rJMSF016A01+ AAGGAAGTGGCCATCATAAGGCATCCACGTATTGGTGAATATGCATTTGGGTTCATTACT
                      ____________________________________________________________
consensus AAGGAAGTGGCCATCATAAGGCATCCACGTATTGGTGAATATGCATTTGGGTTCATTACT
 
. : . : . : . : . : . :
rJMSF016A01+ TCTTCTGTTGTTCTTCAGAACTATTCAGGAGATGAAGAGCTATGCTGTGTGTATGTTCCT
rJMFF033F04+ CAGAACTATTCAGGAGATGAAGAGCTATGCTGTGTGTATGTTCCT
rJMFF020C12+ CAGAACTATTCAGGAGATGAAGAGCTATGCTGTGTGTATGTTCCT
                      ____________________________________________________________
consensus TCTTCTGTTGTTCTTCAGAACTATTCAGGAGATGAAGAGCTATGCTGTGTGTATGTTCCT
 
. : . : . : . : . : . :
rJMSF016A01+ ACAAACCATCTCTACATTGGTGATATATTCCTGGTCAATGCAAACGATGTTATAAGACCG
rJMFF033F04+ ACAAACCATCTCTACATTGGTGATATATTCCTGGTCAATGCAAACGATGTTATAAGACCG
rJMFF020C12+ ACAAACCATCTCTACATTGGTGATATATTCCTGGTCAATGCAAACGATGTTATAAGACCG
                      ____________________________________________________________
consensus ACAAACCATCTCTACATTGGTGATATATTCCTGGTCAATGCAAACGATGTTATAAGACCG
 
. : . : . : . : . : . :
rJMSF016A01+ AACTTGTCAGTTCGTGAAGGGATTGAGATTGTCGTATCTGGTGGCATGTCGATGCCCCAG
rJMFF033F04+ AACTTGTCAGTTCGTGAAGGGATTGAGATTGTCGTATCTGGTGGCATGTCGATGCCCCAG
rJMSF032O20+ TGGCATGTCGATGCCCCAG
rJMFF020C12+ AACTTGTCAGTTCGTGAAGGGATTGAGATTGTCGTATCTGGTGGCATGTCGATGCCCCAG
                      ____________________________________________________________
consensus AACTTGTCAGTTCGTGAAGGGATTGAGATTGTCGTATCTGGTGGCATGTCGATGCCCCAG
 
. : . : . : . : . : . :
rJMSF016A01+ ATTTTATCAACGCTGGATCAAAGAATCGTTCAAAGTTGATAGGGTTAGACCTGACAGAAG
rJMFF033F04+ ATTTTATCAACGCTGGATCAAAGAATCGTTCAAAGTTGATAGGGTTAGACCTGACAGAAG
rJMSF032O20+ ATTTTATCAACGCTGGATCAAAGAATCGTTCAAAGTTGATAGGGTTAGACCTGACAGAAG
rJMFF020C12+ ATTTTATCAACGCTGGATCAAAGAATCGTTCAAAGTTGATAGGGTTAGACCTGACAGAAG
                      ____________________________________________________________
consensus ATTTTATCAACGCTGGATCAAAGAATCGTTCAAAGTTGATAGGGTTAGACCTGACAGAAG
 
. : . : . : . : . : . :
rJMSF016A01+ TTGAGACTGAAGATAATAGACATAGCCGACGGCCTTGAATTCCATCACGTTTTTTAAACG
rJMFF033F04+ TTGAGACTGAAGATAATAGACATAGCCGACGGCCTTGAATTCCATCACGTTTTTTAAACG
rJMSF032O20+ TTGAGACTGAAGATAATAGACATAGCCGACGGCCTTGAATTCCATCACGTTTTTTAAACG
rJMFF020C12+ TTGAGACTGAAGATAATAGACATAGCCGACGGCCTTGAATTCCATCACGTTTTTTAAACG
                      ____________________________________________________________
consensus TTGAGACTGAAGATAATAGACATAGCCGACGGCCTTGAATTCCATCACGTTTTTTAAACG
 
. : . : . : . : . : . :
rJMSF016A01+ TTGCAGACTGGGGCACGGGCACCTCACCAGCACCAACACCTGCAACCCTATCGATTGGCA
rJMFF033F04+ TTGCAGACTGGGGCACGGGCACCTCACCAGCACCAACACCTGCAACCCTATCGATTGGCA
rJMSF032O20+ TTGCAGACTGGGGCACGGGCACCTCACCAGCACCAACACCTGCAACCCTATCGATTGGCA
rJMFF020C12+ TTGCAGACTGGGGCACGGGCACCTCACCAGCACCAACACCTGCAACCCTATCGATTGGCA
                      ____________________________________________________________
consensus TTGCAGACTGGGGCACGGGCACCTCACCAGCACCAACACCTGCAACCCTATCGATTGGCA
 
. : . : . : . : . : . :
rJMSF016A01+ CAAGTTTTTTTCCGATTTATTTGATTTTTGAATCATTAGATTAGATTGAGTTGCTTT
rJMFF033F04+ CAAGTTTTTTTCCGATTTATTTGATTTTTGAATCATTAGATTAGATTGAGTTGCTTTTGT
rJMSF032O20+ CAAGTTTTTTTCCGATTTATTTGATTTTTGAATCATTAGATTAGATTGAGTTGCTTTTGT
rJMFF020C12+ CAAGTTTTTTTCCGATTTATTTGATTTTTGAATCATTAGATTAGATTGAGTTGCTTTTGT
                      ____________________________________________________________
consensus CAAGTTTTTTTCCGATTTATTTGATTTTTGAATCATTAGATTAGATTGAGTTGCTTTTGT
 
. : . : . : . : . : . :
rJMFF033F04+ AACAAGATTTGGTAGTGTACAATGTAGAGAAAGTAGGGTTTGTGTGGAAATATAGTTGAT
rJMSF032O20+ AACAAGATTTGGTAGTGTACAATGTAGAGAAAGTAGGGTTTGTGTGGAAATATAGTTGAT
rJMFF020C12+ AACAAGATTTGGTAGTGTACAATGTAGAGAAAGTAGGGTTTGTGTGGAAATATAGTTGAT
                      ____________________________________________________________
consensus AACAAGATTTGGTAGTGTACAATGTAGAGAAAGTAGGGTTTGTGTGGAAATATAGTTGAT
 
. : . : . : . : . : . :
rJMFF033F04+ TAATACTACTACTTCCATGATTATTTATAGGCTGTTTGAATGTTGAGATCCTTCTTCCCA
rJMSF032O20+ TAATACTACTACTTCCATGATTATTTATAGGCTGTTTGAATGTTGAGATCCTTCTTCCCA
rJMFF020C12+ TAATACTACTACTTCCATGATTATTTATAGGCTGTTTGAATGTTGAGATCCTTCTTCCCA
                      ____________________________________________________________
consensus TAATACTACTACTTCCATGATTATTTATAGGCTGTTTGAATGTTGAGATCCTTCTTCCCA
 
. : . : . : . : . : . :
rJMFF033F04+ AGAGTCTCTCTCCTGGTAATTCCGGAATACCACTTCATCACTTCTGTAAATAAAA
rJMSF032O20+ AGAGTCTCTCTCCTGGTAATTCCGGAATACCACTTCATCACTTCTGTAAATAAAAGGGGG
rJMFF020C12+ AGAGTCTCTCTCCTGGTAATTCCGGAATACCACTTCATCACTTCTGTAAATAAAAGAGGG
                      ____________________________________________________________
consensus AGAGTCTCTCTCCTGGTAATTCCGGAATACCACTTCATCACTTCTGTAAATAAAAGGGGG
 
. : . : . : . : . : . :
rJMSF032O20+ TTTTATTAGTTAAAATAAATTGGTTATTCAGT
rJMFF020C12+ TTTTATTAGTTAAAATAAATTGGTTATTCAGTTGTAAACACCATTATACTTGAGGTATAT
                      ____________________________________________________________
consensus TTTTATTAGTTAAAATAAATTGGTTATTCAGTTGTAAACACCATTATACTTGAGGTATAT